Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.30 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.30 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.30 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 169.85 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 0.75 seconds
write fasta - Current memory usage: 169.85 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 173.08 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 173.08 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.45 seconds
efn2 - Current memory usage: 173.08 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.08 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACAUCACUCUGCCACUCACUCCUUUAUCUCCUACUAGUUAUUUAAAUUGGACUUUUAAUAUCCUACCAGCUGCUCUUCAGACACAC', '-structureDBN', '.................................................(((.........))).......................', '-o', '/disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -1.2 ± 0.3\n kcal/mol, AUC: 0.879', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,9,11,12,17,21,24,25,26,28,30,33,36,38,39,40,42,43,44,48,49,50,51,54,55,56,57,60,62,65,70,72,73,75,77,78,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,13,52,69,45,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,4,68,41,10,76,46,15,16,18,19,20,22,27,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,66,67,6,7,8,71,74,79,80,82,83,84,85,86,23,87,29,31,34,35,37,47,53,58,59,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 115.95912715747866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 115.95912715747866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 115.95912715747866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 115.95912715747866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 115.95912715747868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 354.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 389.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 424.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 442.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 459.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 477.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 494.75, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 512.25, Y: 115.95912715747869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 529.75, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 547.25, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 564.75, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 582.25, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 599.75, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 617.25, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 634.75, Y: 115.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 652.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 669.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 687.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 704.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 722.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 739.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 757.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 774.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 792.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 809.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 827.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 844.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 862.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 862.25, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 862.25, Y: 75.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 849.6722505002105, Y: 63.791559873392245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 844.925391537516, Y: 46.94766465641483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 849.2988797492502, Y: 30.00298770599612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 861.6046824916709, Y: 17.560451993495292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 878.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 895.3953175083291, Y: 17.560451993495292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 907.7011202507498, Y: 30.00298770599612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 912.074608462484, Y: 46.94766465641483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 907.3277494997895, Y: 63.791559873392245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 894.75, Y: 75.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 894.75, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 894.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 912.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 929.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 947.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 964.75, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 982.25, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 999.75, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1017.25, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1034.75, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 1052.25, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1069.75, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1087.25, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1104.75, Y: 115.95912715747873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1122.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1139.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1157.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1174.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 1192.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1209.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1227.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1244.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1262.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1279.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1297.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 135.95912715747866, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 135.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 135.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 135.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 683.5, Y: 135.95912715747872, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 844.357864376269, Y: 130.10126278120967, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 928.323387503327, Y: 47.16865532485076, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 996.0, Y: 135.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 1171.0, Y: 135.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 1293.5, Y: 135.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -1.2 ± 0.3
 kcal/mol, AUC: 0.879', X: 585.0, Y: 148.75912715747876, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 1311.5, 148.75912715747876)
Updated viewBox: -0.25 0.0 1316.75 153.75912715747876
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ce6b256c-08d8-4a29-979d-1f0809d947f2/final_image/CLASP1_fold_final_1.svg
