Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.11 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.11 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.11 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.79 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 172.79 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.18 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.18 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.46 seconds
efn2 - Current memory usage: 176.18 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.18 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCUUACACAUUUUCUCAGAGGCCUUUGUGCUCCCACCUCUUCUACCCUCCCCCUCUUCUUUCCCAUUUUAAAAAAGAAAAGAAGGA', '-structureDBN', '.................(((((..............))))).......(((..((.((((((...........)))))).))..)))', '-o', '/disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -5.3 ± 0.9\n kcal/mol, AUC: 0.469', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,4,5,11,12,13,14,16,19,21,22,25,26,27,28,29,30,32,39,41,42,44,49,55,57,58,60,61,62,67,68,69,70,77,82,85,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,34,71,72,76,46,47,80,51,87,23,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,33,65,6,15,79,81,18,52,24,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,3,7,8,9,10,73,74,75,78,17,83,20,84,35,36,37,38,40,43,45,48,50,53,54,56,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 325.57493555049473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 305.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 285.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 265.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 245.57493555049479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.21097477612403, Y: 236.6263279879944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 276.45487307065656, Y: 222.82212090849663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 271.4540181864529, Y: 206.05187024193975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 272.8929402053055, Y: 188.61113171354947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 280.5746757219434, Y: 172.8872391787972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 293.447728709533, Y: 161.03252012810998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 309.75000204297146, Y: 154.66967947680672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 327.24999795702854, Y: 154.66967947680672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 343.552271290467, Y: 161.03252012811004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 356.4253242780566, Y: 172.8872391787972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.1070597946946, Y: 188.61113171354953, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 365.5459818135471, Y: 206.05187024193975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 360.54512692934344, Y: 222.82212090849663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.78902522387597, Y: 236.62632798799442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 245.57493555049479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 265.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 285.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 305.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 457.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 305.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 285.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 464.37031668259823, Y: 271.4854963293637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 464.37031668259823, Y: 253.98549280549275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 239.89605358436168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 219.8960535843617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 468.07162284851074, Y: 203.72051715427892, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 187.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 167.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 147.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 127.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 107.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 87.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 460.87477833807435, Y: 76.88067778014243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 453.05163083993995, Y: 61.22668478562002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 452.85220631815395, Y: 43.72784587241688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 460.3165686105687, Y: 27.899629642604395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 473.94514786551406, Y: 16.921881196689128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 491.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 508.0548521344858, Y: 16.921881196689128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 521.6834313894313, Y: 27.899629642604395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 529.147793681846, Y: 43.727845872416765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 528.9483691600601, Y: 61.22668478562002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 521.1252216619257, Y: 76.88067778014243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 87.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 107.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 127.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 147.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 167.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 187.54498072419614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 513.9283771514893, Y: 203.72051715427892, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 219.8960535843617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 239.89605358436168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 517.6296833174017, Y: 253.98549280549275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 517.6296833174018, Y: 271.4854963293637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 285.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 305.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 325.5749355504948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 345.57493555049473, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 345.57493555049473, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 278.5, Y: 285.5749355504948, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 327.1997629847272, Y: 135.0148648315393, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 351.0, Y: 305.5749355504948, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 451.0, Y: 305.5749355504948, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 451.0, Y: 127.54498072419614, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 533.6509318780603, Y: 15.531922563685214, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 530.1783771514893, Y: 203.72051715427892, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 503.5, Y: 345.5749355504948, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -5.3 ± 0.9
 kcal/mol, AUC: 0.469', X: 200.948896840923, Y: 358.3749355504948, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 551.6509318780603, 358.3749355504948)
Updated viewBox: -0.25 0.0 556.9009318780603 363.3749355504948
Updated SVG: /disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/cfb04f1b-b576-4c84-af86-f375140c06a2/final_image/HCFC1_fold_final_1.svg
