Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 37% [===================                               ] \                     
 43% [======================                            ] |                     
 49% [=========================                         ] /                     
 55% [============================                      ] -                     
 61% [===============================                   ] \                     
 67% [==================================                ] |                     
 74% [======================================            ] /                     
 80% [=========================================         ] -                     
 86% [============================================      ] \                     
 92% [===============================================   ] |                     
 98% [==================================================] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.58 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.58 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.58 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.20 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.55 seconds
write fasta - Current memory usage: 172.20 MB
Length of region: 81 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.53 seconds
efn2 - Current memory usage: 175.79 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.79 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCCUGACCGAAGUGGCCAAUGGCAUCGAGUCCCUGGGUGUGAAGCCAGACCUGCCGCCCCCACCCAGCAAAGCCCCCAUGA', '-structureDBN', '....((((((....(((...))).))).))).(((((((....((..........))...)))))))..............', '-o', '/disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -20.3 ± 0.8\n kcal/mol, AUC: 0.72', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '67,4,5,72,9,12,13,14,15,79,80,20,21,22,25,27,29,30,34,35,36,37,38,39,40,41,44,48,52,53,56', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,2,3,7,8,74,16,23,58,59', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,66,6,73,75,77,78,17,31,33,42,43,45,46,47,51,54,57,61,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,69,70,71,10,11,76,81,18,19,24,26,28,32,49,50,55,60,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 278.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 258.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.93439675932206, Y: 241.52321667767015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.42290491375286, Y: 223.4247497104707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.91141306818369, Y: 205.32628274327126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.8479511718796, Y: 198.38263071478698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 28.195631098507107, Y: 183.7853080565781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 28.09619880865108, Y: 166.28561592195982, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.58201864504281, Y: 151.57955140359851, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 53.56553902140274, Y: 144.4538101814396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.87081895474688, Y: 126.25979124034822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.17609888809102, Y: 108.06577229925685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.28803440253304, Y: 92.55940927945292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 95.73559819911088, Y: 91.20541169571922, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 106.14271144947209, Y: 105.27462580620053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 99.74137966736447, Y: 121.56185219094115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 91.43609973402033, Y: 139.75587113203252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 83.13081980067619, Y: 157.9498900731239, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 88.21808373188716, Y: 174.69413522464387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.32142188988277, Y: 191.49510849422134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 91.83291373545197, Y: 209.59357546142078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 100.34440558102114, Y: 227.69204242862023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.06563449224359, Y: 241.52335656116628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.25, Y: 258.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.25, Y: 278.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 278.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 258.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 238.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 218.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 198.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 178.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 129.01006161368247, Y: 167.15871125864575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.71878381999545, Y: 150.82861836625116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.85856897290822, Y: 133.45986971670968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.9252233852735, Y: 119.1450319916922, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 150.54675957110572, Y: 111.25708439131418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.40098120785694, Y: 91.8551120095872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.25926309844132, Y: 77.59346180711532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.9676280182166, Y: 60.24418166736319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.05853947970078, Y: 43.83839274159442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.11676861892474, Y: 32.1879951322407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.1082239198629, Y: 27.999969408258664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.08492516070632, Y: 32.24740718739787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.10232023903993, Y: 43.94341240640705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 215.13580547033433, Y: 60.3704075263999, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.78349502786983, Y: 77.71156516626888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 202.59195040022544, Y: 91.9376514450473, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.92918632816327, Y: 99.74322216930787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 182.0749646914121, Y: 119.14519455103485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.1414980541403, Y: 133.460043696488, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.28120098212156, Y: 150.82874173001912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 187.9899026366037, Y: 167.1587620952141, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 178.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.75, Y: 198.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 218.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 238.60231828082598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 258.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.75, Y: 278.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 298.602318280826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 318.602318280826, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 34.31941388322218, Y: 217.5341106345744, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 122.22082334692709, Y: 102.6581437057452, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 123.5, Y: 278.602318280826, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 108.90026376748119, Y: 178.66336311915106, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 175.39320489635963, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 200.59968065034263, Y: 178.66344215774444, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 223.5, Y: 318.602318280826, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 398.5, Y: 318.602318280826, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '81', X: 416.0, Y: 318.602318280826, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -20.3 ± 0.8
 kcal/mol, AUC: 0.72', X: 150.75, Y: 331.402318280826, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 434.0, 331.402318280826)
Updated viewBox: -0.25 -5.0 439.25 341.402318280826
Updated SVG: /disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/d0f65cc5-e911-44bb-8658-545940ff8d33/final_image/HCFC1_fold_final_1.svg
