Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.22 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.22 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.22 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.86 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.43 seconds
write fasta - Current memory usage: 171.86 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 175.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.10 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.10 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGCAUGGAAGAAAUUAUCUUAGUAGGCAAUUGUAACACUUUUUGAAAGUAACCCAUUUCAGAUUUGAAAUACUGCAAUAAUGGUUGUC', '-structureDBN', '..((..(((........)))..)).(((((((((.......(((((((........))))))).................)))))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -4.6 ± 1.1\n kcal/mol, AUC: 0.588', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,6,7,8,11,15,16,18,20,21,23,24,26,27,31,32,33,34,40,41,42,43,44,45,49,50,57,58,59,62,64,65,66,67,71,74,75,79,82,83,84,85,86,87,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '17,89,12,28,25', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '4,70,39,10,61,52,56,29,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,68,5,69,72,9,73,76,13,14,77,78,80,81,19,22,35,36,37,38,46,47,48,51,53,54,55,60,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 114.24303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.74303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.24303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 149.24303257401746, Y: 376.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.8633492566157, Y: 362.4768781458383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.8633492566157, Y: 344.9768746219674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.24303257401746, Y: 330.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.24303257401746, Y: 310.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.24303257401743, Y: 290.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.58796449973374, Y: 277.8333212126562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 134.90482188346914, Y: 260.5402227408664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.0562779673128, Y: 244.5681475802904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 156.7430253018171, Y: 235.05237321418323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.24303984621775, Y: 235.05237321418323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.9297871807221, Y: 244.5681475802904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 196.08124326456573, Y: 260.5402227408664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 193.39810064830115, Y: 277.8333212126562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 181.74303257401743, Y: 290.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 181.74303257401746, Y: 310.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 181.74303257401746, Y: 330.88743540083635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.12271589141923, Y: 344.9768746219674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.12271589141923, Y: 362.4768781458383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 181.74303257401746, Y: 376.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 181.74303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 199.24303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.74303257401746, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.74303257401746, Y: 376.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.74303257401746, Y: 356.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.74303257401746, Y: 336.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.74303257401746, Y: 316.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.74303257401746, Y: 296.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.74303257401746, Y: 276.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.74303257401746, Y: 256.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.74303257401746, Y: 236.5663173669694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.0392349213405, Y: 231.34773644378387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.80171089882936, Y: 222.7414419718984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 171.7084515501479, Y: 211.13036956227253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 161.34203922644838, Y: 197.03115190991818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 154.16372568359424, Y: 181.0711313098723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.49290876361522, Y: 163.96044616831807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.49292084196804, Y: 146.4604335148008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 154.16376138122848, Y: 129.3497534403931, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 136.74946759275676, Y: 119.51398342230118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 119.33517380428506, Y: 109.67821340420926, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 101.92088001581334, Y: 99.84244338611734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 84.50658622734164, Y: 90.00667336802542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 67.09229243886995, Y: 80.1709033499335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 49.67799865039825, Y: 70.33513333184158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 32.57976121314397, Y: 74.06350906310979, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 16.202867663142058, Y: 67.89521377947267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 5.812751067009515, Y: 53.813453016947165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 36.345737962487306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 13.35630591859939, Y: 21.10821823355127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 28.864603895209825, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 46.288728224859426, Y: 14.628005036584796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.026544404929325, Y: 25.468803699821933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 65.66112492979761, Y: 42.03690592557507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.07541871826933, Y: 51.87267594366699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 100.48971250674103, Y: 61.70844596175891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.90400629521272, Y: 71.54421597985083, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 135.31830008368442, Y: 81.37998599794275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 152.73259387215614, Y: 91.21575601603467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.14688766062784, Y: 101.0515260341266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 182.9055081916348, Y: 89.07372982005757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.89276139104066, Y: 80.03867356473188, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.4417929373027, Y: 74.34836998049116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 231.81625754705675, Y: 72.25600779281785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.24308248606997, Y: 73.85468616728417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.94686525952056, Y: 79.0732722839806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 281.18437496442846, Y: 87.6795663756809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.27762217464135, Y: 99.29063340211098, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 304.6440259215865, Y: 113.38984165489319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.82233549804425, Y: 129.34985016443147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.49315370035487, Y: 146.4605220894491, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.49314833220194, Y: 163.96052208944832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.8223196324402, Y: 181.0711917624039, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 304.64400026446765, Y: 197.03119586802345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.2775878676152, Y: 211.13039776098114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 281.1843335339781, Y: 222.7414567546601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.9468185490841, Y: 231.3477414980981, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.24303257401743, Y: 236.5663173669694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.24303257401743, Y: 256.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.24303257401743, Y: 276.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.24303257401743, Y: 296.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.24303257401743, Y: 316.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.24303257401743, Y: 336.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.24303257401743, Y: 356.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.24303257401743, Y: 376.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.24303257401743, Y: 396.56631736696943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 114.99303257401746, Y: 416.56631736696943, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 115.75473652321526, Y: 286.3771415495581, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 197.74159767688266, Y: 327.72607867027034, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 192.99303257401746, Y: 316.56631736696943, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 126.85445545792669, Y: 166.06981221228654, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 0.3863103775347341, Y: 83.84507883448669, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 123.98977631330465, Y: 54.12992219137914, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 289.0519485946548, Y: 71.39976346083364, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 270.14104703432827, Y: 249.70228409044387, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 245.49303257401743, Y: 416.56631736696943, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -4.6 ± 1.1
 kcal/mol, AUC: 0.588', X: 94.12157685017743, Y: 429.36631736696944, Width: 142.5, Height: 23
Calculated bounding box: (0.3863103775347341, 5.0, 325.99315370035487, 429.36631736696944)
Updated viewBox: -4.613689622465266 0.0 335.6068433228201 434.36631736696944
Updated SVG: /disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/d11534f1-ee18-40df-b319-375c65243dca/final_image/CALD1_fold_final_1.svg
