Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/final_image/IQGAP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.78 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.78 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.78 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.40 MB
Based on canonical annotations, the following gene is in your area of interest: IQGAP1(+)
write fasta - Elapsed time since the previous call: 0.67 seconds
write fasta - Current memory usage: 172.40 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.97 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/fasta/IQGAP1.fasta" "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/ct/IQGAP1.ct" --SHAPE "IQGAP1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.97 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/ct/IQGAP1.ct" "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/fold_FE/IQGAP1.txt" -sh "IQGAP1.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 175.97 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/ct/IQGAP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/fold_dbn/IQGAP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.03 seconds
ct2dot - Current memory usage: 175.97 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGCCGAUCUCUAUCAGAAGGAGCUGGCUACCCUGCAGCGACAAAGUCCUGAACAUAAUCUCACCCACCCAGAGCUCUCUGUC', '-structureDBN', '.((((..((((.......)))).)))).......(((.(((...))))))..................((((....))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/final_image/IQGAP1_fold_1.svg', '-title', 'IQGAP1, -15.3 ± 0.8\n kcal/mol, AUC: 0.603', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,5,7,9,11,13,16,19,20,22,24,25,26,28,33,34,37,39,45,46,49,50,55,58,60,71,73,75,77,79,80,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,1,65,3,4,66,78,48,27,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,69,70,76,14,29,31,36,38,40,42,43,47,51,52,54,56,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,68,6,8,72,10,74,12,15,17,18,82,21,23,30,35,41,44,53,57,59,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 195.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 175.9625634112413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 155.9625634112413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 13.452864972254645, Y: 140.8344869534777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 16.50956638777143, Y: 123.60355957086986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.973486156485876, Y: 112.4245101269347, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 36.85284558024284, Y: 93.64488249700642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 43.73220500399981, Y: 74.86525486707814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 50.611564427756775, Y: 56.08562723714988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.62513210469592, Y: 39.31107254511642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 51.506289774263564, Y: 22.82889499194789, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.98534415173407, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.474447684614, Y: 13.617616421975356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 97.22409575583589, Y: 24.443389851436677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 101.92793787320369, Y: 41.2993698515246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 95.77063776007856, Y: 57.68039081315561, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 81.12845932639027, Y: 67.26458630075496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.24909990263328, Y: 86.04421393068321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 67.36974047887631, Y: 104.8238415606115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 60.490381055119315, Y: 123.60346919053978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 63.547144158690855, Y: 140.8344354817448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 54.75, Y: 155.9625634112413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 175.9625634112413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 195.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 195.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 175.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 190.93438113341733, Y: 158.88353174980634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 201.65572209255677, Y: 145.05222241680394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.16734010780456, Y: 126.95381478622747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 218.67895812305235, Y: 108.85540715565097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.966684242381, Y: 93.44228327814295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.42851574262102, Y: 92.28676064762683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.67498229603387, Y: 106.4733992580307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 248.08887052273917, Y: 122.68678643042864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 239.57725250749138, Y: 140.78519406100511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.06563449224356, Y: 158.88360169158162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 175.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 195.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 489.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 524.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 559.75, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 195.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 559.75, Y: 175.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 155.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 556.201265612761, Y: 138.82611874365014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 567.249982120067, Y: 125.25493179711637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 584.750017879933, Y: 125.25493179711637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 595.798734387239, Y: 138.82611874365014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 592.25, Y: 155.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 592.25, Y: 175.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 592.25, Y: 195.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 592.25, Y: 215.96256341124132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 609.75, Y: 215.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 627.25, Y: 215.96256341124135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 235.96256341124132, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 21.202577374071524, Y: 67.98589544332114, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 89.27872753256158, Y: 92.92357335444015, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 103.5, Y: 235.96256341124132, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 188.3189324772281, Y: 118.44219677097968, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 237.64213562373095, Y: 230.10469903497227, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 398.5, Y: 235.96256341124132, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 536.0, Y: 195.96256341124132, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 602.642135623731, Y: 230.10469903497227, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 623.5, Y: 235.96256341124135, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'IQGAP1, -15.3 ± 0.8
 kcal/mol, AUC: 0.603', X: 250.0, Y: 248.76256341124136, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 641.5, 248.76256341124136)
Updated viewBox: -0.25 0.0 646.75 253.76256341124136
Updated SVG: /disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/final_image/IQGAP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/d370d53a-7013-4e03-9265-41ee48482299/final_image/IQGAP1_fold_final_1.svg
