Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 25% [=============                                     ] /                     
 31% [================                                  ] -                     
 37% [===================                               ] \                     
 43% [======================                            ] |                     
 50% [==========================                        ] /                     
 56% [=============================                     ] -                     
 62% [================================                  ] \                     
 68% [===================================               ] |                     
 75% [======================================            ] /                     
 81% [=========================================         ] -                     
 87% [============================================      ] \                     
 93% [===============================================   ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.02 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.02 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.02 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.71 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 0.62 seconds
write fasta - Current memory usage: 172.71 MB
Length of region: 80 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.02 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.02 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 176.02 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.02 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCUCGUCUUCAGAGUAACACAAGAGCACUUUAUCAGUAUUGCCCCAUUCCUAUAAUCAACUAUCCACAACUCGAAAAUGA', '-structureDBN', '.(((.......)))..........(((............)))......................................', '-o', '/disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -2.0 ± 0.7\n kcal/mol, AUC: 0.614', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,6,71,8,9,73,12,14,15,78,79,23,25,29,30,31,33,36,37,39,40,41,47,48,51,53,56,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,35,10,42,43,44,75,77,17,26', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,2,65,68,7,13,21,24,27,28,46,49,50,52,54,55,59,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,4,69,70,72,74,11,76,16,80,18,19,20,22,32,34,38,45,57,58,60']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 112.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 92.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 11.797923343555624, Y: 78.32960878705569, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 11.650879723203218, Y: 60.8302210662753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 21.865617135923458, Y: 46.620740709215795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 38.5, Y: 41.18497957025812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.13438286407654, Y: 46.620740709215795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.34912027679678, Y: 60.8302210662753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.20207665644438, Y: 78.32960878705569, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 92.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 54.75, Y: 112.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 132.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 112.36543031613965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 92.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.90937677557255, Y: 82.33569092036845, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 223.9330543069434, Y: 67.31321503417519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 221.89509968812027, Y: 49.93230919518939, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.15288391549737, Y: 33.24084874888874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.78441413859161, Y: 20.16580949535998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 254.75001218840742, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 272.2499878115926, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.2155858614084, Y: 20.16580949535998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.84711608450266, Y: 33.24084874888874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.10490031187976, Y: 49.93230919518936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.0669456930566, Y: 67.31321503417519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.0906232244275, Y: 82.33569092036842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 92.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.75, Y: 112.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 577.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 594.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 612.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 629.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 664.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 682.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 699.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 717.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 734.75, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 752.25, Y: 132.36543031613968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 769.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 787.25, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 804.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 822.25, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 839.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 857.25, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 874.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 892.25, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 909.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 927.25, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 944.75, Y: 132.3654303161397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 152.36543031613965, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 80.66136522867777, Y: 54.777881238201545, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 156.0, Y: 152.36543031613965, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 198.23380799160134, Y: 48.05069739246905, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 294.6118440969759, Y: 99.68658181777258, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 416.0, Y: 152.36543031613968, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 591.0, Y: 152.36543031613968, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 766.0, Y: 152.3654303161397, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 941.0, Y: 152.3654303161397, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -2.0 ± 0.7
 kcal/mol, AUC: 0.614', X: 408.75, Y: 165.16543031613972, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 959.0, 165.16543031613972)
Updated viewBox: -0.25 0.0 964.25 170.16543031613972
Updated SVG: /disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/d4ce22fe-df00-494c-b078-68337d1f1fcb/final_image/DNAJC13_fold_final_1.svg
