Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/final_image/ZBTB20_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.67 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.67 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.67 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.27 MB
Based on canonical annotations, the following gene is in your area of interest: ZBTB20(-)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 172.27 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.50 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/fasta/ZBTB20.fasta" "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/ct/ZBTB20.ct" --SHAPE "ZBTB20.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.50 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/ct/ZBTB20.ct" "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/fold_FE/ZBTB20.txt" -sh "ZBTB20.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 175.50 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/ct/ZBTB20.ct" 1 "/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/fold_dbn/ZBTB20_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.50 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCAGGAAACAGAUAGAUAAGAUAAAAGCAAAUGUUCCAGAUUUAAGACUUCUUAGGAUGAGUACAAGGAAGAGAGAAAUAGUAUGGAAA', '-structureDBN', '...((((.((.....................))))))...((((((....)))))).................................', '-o', '/disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/final_image/ZBTB20_fold_1.svg', '-title', 'ZBTB20, -4.7 ± 0.6\n kcal/mol, AUC: 0.588', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,11,13,15,17,20,22,27,32,33,34,35,39,41,42,43,46,49,50,52,53,55,56,58,59,61,62,67,68,71,73,75,79,81,82,84,85,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '3,19,23,6,54,25,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,7,72,10,80,24,89,26,88,28,29,30,31,37,38,45,57,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,65,66,69,70,8,9,74,12,76,77,78,16,18,83,21,87,36,40,44,47,48,51,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 233.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 213.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 193.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.43438113341733, Y: 176.8644092396005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 64.1557220925568, Y: 163.03309990659807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.66734010780453, Y: 144.9346922760216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 60.695290141712235, Y: 132.17066817297737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 52.456649310339856, Y: 116.73126763586615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 48.51893454426613, Y: 99.6800303166934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 49.153394444234266, Y: 82.19152688360802, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.31632438197187, Y: 65.4704489831939, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 63.65207708373208, Y: 50.668624325899685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.51756131318268, Y: 38.80567329188361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.0265410673531, Y: 30.6987726092284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.11068374543663, Y: 26.906364317840143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 126.59315200099707, Y: 27.689687614460354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.2696699193042, Y: 32.99478344904105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.99147929430814, Y: 42.456211481835595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.74447158067085, Y: 55.422223359448566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.71904453404258, Y: 70.99965825435535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.3658714805453, Y: 88.11546804869371, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 180.43374156181153, Y: 105.59063401380851, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.98686433876375, Y: 122.22138325161345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 165.4004467303748, Y: 136.8621103213758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.33484696899288, Y: 148.5042920142151, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.6900859712373, Y: 156.34595924872656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 119.54384959850313, Y: 159.84694053174326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 102.07725250749138, Y: 158.76607155079927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.56563449224359, Y: 176.86447918137577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 193.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 213.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 233.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 253.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 233.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 213.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 193.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 173.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 153.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 156.2012656127609, Y: 136.80699623344427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 167.24998212006702, Y: 123.2358092869105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.75001787993298, Y: 123.2358092869105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.7987343872391, Y: 136.80699623344427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.25, Y: 153.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 173.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 193.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 213.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 233.94344090103544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 253.94344090103547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 454.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 489.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 524.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 577.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 594.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 612.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 629.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 664.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 682.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 699.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 717.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 734.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 752.25, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 769.75, Y: 253.9434409010355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 273.94344090103544, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 49.48399798355918, Y: 140.20761983295165, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 126.35259663583119, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 139.4781373318367, Y: 175.24712017619777, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 138.5, Y: 273.9434409010355, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 211.4776376399694, Y: 132.06171242780675, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 258.5, Y: 273.9434409010355, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 433.5, Y: 273.9434409010355, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 608.5, Y: 273.9434409010355, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 766.0, Y: 273.9434409010355, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ZBTB20, -4.7 ± 0.6
 kcal/mol, AUC: 0.588', X: 321.25, Y: 286.7434409010355, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 784.0, 286.7434409010355)
Updated viewBox: -0.25 -5.0 789.25 296.7434409010355
Updated SVG: /disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/final_image/ZBTB20_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/d98adea1-fc94-4666-b4a2-4bfb6465db64/final_image/ZBTB20_fold_final_1.svg
