Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/final_image/DDX3X_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.40 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.40 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.40 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.10 MB
Based on canonical annotations, the following gene is in your area of interest: DDX3X(+)
write fasta - Elapsed time since the previous call: 0.26 seconds
write fasta - Current memory usage: 173.10 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.28 seconds
write dat - Current memory usage: 176.37 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/fasta/DDX3X.fasta" "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/ct/DDX3X.ct" --SHAPE "DDX3X.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.37 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/ct/DDX3X.ct" "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/fold_FE/DDX3X.txt" -sh "DDX3X.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.37 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/ct/DDX3X.ct" 1 "/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/fold_dbn/DDX3X_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.37 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACAAGCUAAUAUGGAAACCACAUGUAACUUAGCCAGACUAUACCUUGUGUAGCUUCAAGAACUCGCAGUACAUUACCAGCUGUGA', '-structureDBN', '.....(((((((((.......)))))....)))).((.((((((...))))))))........(((((((.........)))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/final_image/DDX3X_fold_1.svg', '-title', 'DDX3X, -17.6 ± 1.4\n kcal/mol, AUC: 0.54', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '6,8,11,13,14,15,24,25,26,30,31,33,37,40,42,46,47,48,49,50,51,53,55,56,60,64,66,69,70,74,75,80,82,83,84,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '67,68,71,73,76,78,79,81,19,20,21,86,34,35,36,38,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,65,39,72,77,16,18,52,22,23', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,4,5,7,9,10,12,17,27,28,29,41,43,44,45,54,57,58,59,61,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 48.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 83.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 135.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.59850515650095, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.59850515650095, Y: 155.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 135.59850515650095, Y: 135.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 125.21881604972401, Y: 121.86967031699118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 106.11758133189, Y: 115.94153129583015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.01634661405598, Y: 110.01339227466906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 67.91511189622196, Y: 104.08525325350803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 48.81387717838791, Y: 98.15711423234694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 32.31073293019318, Y: 103.97917764249308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.554152565361534, Y: 98.93267321809944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 5.010940761792256, Y: 84.96517962427365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 67.46711966474322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 14.872034176738794, Y: 53.19145447696937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 31.470684325034057, Y: 47.6475383806542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 48.140095187503334, Y: 52.97491427565902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.44710308777462, Y: 67.11760781586668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 77.54833780560864, Y: 73.0457468370277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 96.64957252344266, Y: 78.9738858581888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 115.75080724127668, Y: 84.90202487934982, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.8520419591107, Y: 90.83016390051091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.38493281572715, Y: 85.09313331638393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 168.09851422343905, Y: 90.28025164237064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.47819078965418, Y: 104.36969146021877, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.4781873160263, Y: 121.86969146021843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 168.09850515650095, Y: 135.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 168.09850515650095, Y: 155.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 168.09850515650095, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 168.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 203.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 203.09850515650095, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 199.28288628991828, Y: 158.8800954960437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 210.00422724905772, Y: 145.0487861630413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.5158452643055, Y: 126.95037853246484, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.0274632795533, Y: 108.85197090188836, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 235.5390812948011, Y: 90.75356327131186, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.0506993100489, Y: 72.65515564073536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.5623173252967, Y: 54.55674801015891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 260.8500434446253, Y: 39.1436241326509, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 278.3118749448654, Y: 37.988101502134754, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 288.5583414982782, Y: 52.17474011253864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 281.97222972498344, Y: 68.38812728493656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 273.46061170973564, Y: 86.48653491551306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.94899369448785, Y: 104.58494254608954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 256.43737567924006, Y: 122.68335017666601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.92575766399227, Y: 140.7817578072425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 239.41413964874448, Y: 158.880165437819, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 235.59850515650095, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 235.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 253.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 305.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 323.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 340.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 358.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 375.59850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 393.09850515650095, Y: 195.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 393.09850515650095, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 393.09850515650095, Y: 155.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 393.09850515650095, Y: 135.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 393.09850515650095, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 393.09850515650095, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 393.09850515650095, Y: 75.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 380.5207556567114, Y: 63.79155987339223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 375.77389669401697, Y: 46.947664656414815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 380.14738490575115, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 392.4531876481719, Y: 17.560451993495292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 409.34850515650095, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.24382266483, Y: 17.560451993495292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 438.5496254072508, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 442.9231136189849, Y: 46.947664656414815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 438.1762546562905, Y: 63.79155987339223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 425.59850515650095, Y: 75.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 425.59850515650095, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 425.59850515650095, Y: 115.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 425.59850515650095, Y: 135.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 425.59850515650095, Y: 155.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 425.59850515650095, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 425.59850515650095, Y: 195.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 48.84850515650095, Y: 215.9591271574787, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 102.4682295567284, Y: 128.11288366607616, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 27.590508049136233, Y: 27.64796203171136, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 193.72876885207873, Y: 128.11291989523687, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 196.66743763372904, Y: 118.43876051721702, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 279.2974013250643, Y: 113.09656056133736, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 319.34850515650095, Y: 215.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 370.06864428550534, Y: 81.27767628248012, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 441.12836602749655, Y: 81.27767628248012, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 421.84850515650095, Y: 215.95912715747872, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DDX3X, -17.6 ± 1.4
 kcal/mol, AUC: 0.54', X: 162.33655680949246, Y: 228.75912715747873, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 459.12836602749655, 228.75912715747873)
Updated viewBox: -0.25 0.0 464.37836602749655 233.75912715747873
Updated SVG: /disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/final_image/DDX3X_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/df81cb33-f22d-40ac-ae84-1842845eabd0/final_image/DDX3X_fold_final_1.svg
