Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.04 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.04 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.04 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.70 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 0.81 seconds
write fasta - Current memory usage: 170.70 MB
Length of region: 84 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.66 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.66 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 173.66 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.66 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCUGUGACACCGUCUUCAGAAAAGCGAAGCAAGAUUCCCAGGAGCCAGGGAUGUAGCCGGGAAACAAGUCCAAACCGAAUAGGA', '-structureDBN', '.(((.(((...)))..))).........((.....((((........))))....)).(((.......)))...((.....)).', '-o', '/disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -16.7 ± 1.0\n kcal/mol, AUC: 0.722', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,6,12,13,15,16,19,24,26,29,33,35,36,41,42,44,48,49,50,52,53,54,56,59,60,61,68,69,77,80,82,83', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,2,38,70,71,72,74,14,78,51,57,28', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,67,37,39,73,11,43,45,46,47,75,17,21,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,7,8,9,10,76,79,81,18,20,84,22,23,25,27,30,31,32,34,40,55,58,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 11.877435655349473, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.377435655349473, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 29.377435655349473, Y: 203.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.377435655349473, Y: 183.58666783409188, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 20.580305193116516, Y: 168.45861711218765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 23.63697576470554, Y: 151.22770918396645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.75750056498765, Y: 132.44812396553135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 9.878025365269764, Y: 113.66853874709625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 96.93670837066821, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 16.209691240697794, Y: 83.71073889541677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 33.50116723955671, Y: 86.4043702126717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.39485134522681, Y: 102.4893915475547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 47.2743265449447, Y: 121.2689767659898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.15380174466259, Y: 140.0485619844249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 67.61781671046882, Y: 151.2275736133904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 70.67457981404033, Y: 168.4585399045954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.87743565534947, Y: 183.58666783409188, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 61.87743565534947, Y: 203.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 61.87743565534947, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.37743565534947, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.87743565534947, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 114.37743565534947, Y: 223.5866678340919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.87743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.37743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.87743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.37743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.87743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 219.37743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 236.87743565534947, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 236.87743565534947, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.58184182612393, Y: 193.49287015018388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.71822158215133, Y: 178.40363588251813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.86280720439993, Y: 161.00230857392785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.34555010733538, Y: 144.38339510540737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.19144503193456, Y: 131.50226440778562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 245.2939168471375, Y: 124.64958930572129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.51088307723035, Y: 105.09921345730709, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 253.72784930732314, Y: 85.54883760889297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 257.944815537416, Y: 65.99846176047876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.30420540262764, Y: 50.7803683991925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 250.3276036859445, Y: 33.31030357367061, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 260.6859714799058, Y: 19.20517239032958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.0489279566713, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.15552104145866, Y: 16.689848517993568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 306.50570760271853, Y: 29.088372662274168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 310.1287052390145, Y: 46.20924872577129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.8596622954106, Y: 62.54784137096206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.714176291089, Y: 72.85103188437958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 285.49721006099617, Y: 92.40140773279379, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 281.2802438309034, Y: 111.95178358120796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.0632776008105, Y: 131.5021594296221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 288.9092474562242, Y: 144.38326955975572, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.3920525283143, Y: 161.00219998687595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 292.5366725374287, Y: 178.40356674611132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 283.6730541247096, Y: 193.49284335679442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 269.3774356553495, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 269.3774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 286.8774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 304.3774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 304.3774356553495, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 304.3774356553495, Y: 183.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.9253589989051, Y: 169.55084630500795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.7783153785527, Y: 152.05145858422753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.99305279127293, Y: 137.84197822716806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 320.6274356553495, Y: 132.40621708821038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.261818519426, Y: 137.84197822716806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 347.47655593214625, Y: 152.05145858422753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 347.32951231179385, Y: 169.55084630500795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 336.8774356553495, Y: 183.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 336.8774356553495, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 336.8774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.3774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 371.8774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.3774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 406.8774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 406.8774356553495, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 400.2292660505316, Y: 187.3986275344373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 406.955485306571, Y: 171.24286130818393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 423.1274356553495, Y: 164.5556474074395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.29938600412794, Y: 171.24286130818393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 446.02560526016737, Y: 187.3986275344373, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.3774356553495, Y: 203.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.3774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 456.8774356553495, Y: 223.58666783409194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 12.627435655349473, Y: 243.5866678340919, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 5.580216040979895, Y: 64.93115367698167, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 75.62743565534947, Y: 243.5866678340919, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 225.0889192732596, Y: 221.90011246842744, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 226.07606013611812, Y: 55.319295252177994, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 297.0806196793175, Y: 116.16874981130084, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 280.6274356553495, Y: 203.58666783409194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 353.1274356553495, Y: 203.58666783409194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 449.6744479999578, Y: 157.08367264449407, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 453.1274356553495, Y: 243.58666783409194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -16.7 ± 1.0
 kcal/mol, AUC: 0.722', X: 164.81371782767474, Y: 256.38666783409195, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.000000000000028, 471.1274356553495, 256.38666783409195)
Updated viewBox: -0.25 2.842170943040401e-14 476.3774356553495 261.3866678340919
Updated SVG: /disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/e0176d54-49a0-4fea-a4f1-1bbed1c9e9b8/final_image/CLASP1_fold_final_1.svg
