Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/final_image/LMNA_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.09 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.09 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.09 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 169.63 MB
Based on canonical annotations, the following gene is in your area of interest: LMNA(+)
write fasta - Elapsed time since the previous call: 0.96 seconds
write fasta - Current memory usage: 169.63 MB
Length of region: 84 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.15 seconds
write dat - Current memory usage: 172.78 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/fasta/LMNA.fasta" "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/ct/LMNA.ct" --SHAPE "LMNA.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 172.78 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/ct/LMNA.ct" "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/fold_FE/LMNA.txt" -sh "LMNA.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 172.78 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/ct/LMNA.ct" 1 "/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/fold_dbn/LMNA_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 172.78 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGAAAAAUAACCCUUUGGUUUUUUUCUUCUGUAUUUUUUUUUCUAAGAGAAGUUAUUUUCUACAGUGGUUUUAUACUGAAGGAA', '-structureDBN', '(((((((.((((....)))))))))))...(((.(((((((....))))))).))).((((.(((((......))))).)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/final_image/LMNA_fold_1.svg', '-title', 'LMNA, -16.0 ± 1.0\n kcal/mol, AUC: 0.828', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,8,14,15,16,17,18,19,20,21,22,23,24,25,27,28,30,31,32,34,35,36,37,38,39,40,41,42,44,47,49,52,53,54,56,57,58,59,61,65,66,67,68,69,70,71,72,74,77,78,81,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,83,3,33', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,4,5,9,10,73,12,75,76,84,26,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '6,7,11,13,79,80,29,43,45,46,48,50,51,55,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 8.565618866582668, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 182.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 162.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 142.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.565618866582668, Y: 122.80167645590731, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 105.72264479447236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.47134095913944, Y: 91.89133546146999, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 23.982958974387245, Y: 73.79292783089349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 32.494576989635036, Y: 55.69452020031699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 41.00619500488284, Y: 37.596112569740484, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 45.08781648673627, Y: 20.57872094600873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.86166320905218, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 76.69780224563816, Y: 20.447680982057705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.9203730377128, Y: 37.430647374961694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 70.41610740456963, Y: 51.42749184451819, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 61.904489389321824, Y: 69.52589947509463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 53.39287137407403, Y: 87.62430710567114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 44.88125335882623, Y: 105.72271473624764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 122.80167645590731, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 142.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 162.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 182.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 41.06561886658267, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 41.06561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 58.56561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 76.06561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.56561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 111.06561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.06561886658267, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.38724171509341, Y: 186.62614002582455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 170.45060359574182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 150.45060359574182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 130.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 110.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 90.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 70.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.06561886658267, Y: 50.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.51688447934356, Y: 33.31415892815065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.56560098664966, Y: 19.742971981616847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 136.06563674651562, Y: 19.742971981616847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 147.11435325382178, Y: 33.31415892815059, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.56561886658267, Y: 50.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 143.56561886658267, Y: 70.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.56561886658267, Y: 90.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 143.56561886658267, Y: 110.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.56561886658267, Y: 130.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.56561886658267, Y: 150.45060359574182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 143.56561886658267, Y: 170.45060359574177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.24399601807193, Y: 186.62614002582455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.56561886658267, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.56561886658267, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.56561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 161.06561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.56561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.56561886658267, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.56561886658267, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.56561886658267, Y: 182.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.8872417150934, Y: 166.62614002582455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.56561886658267, Y: 150.45060359574182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.56561886658267, Y: 130.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.56561886658267, Y: 110.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.56561886658267, Y: 90.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.56561886658267, Y: 70.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 169.71871877507982, Y: 55.35154698315702, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 172.68392388997577, Y: 38.104613619638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.06563098346143, Y: 26.827243931486947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 203.56560674970387, Y: 26.82724393148689, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.94731384318953, Y: 38.104613619637945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 219.9125189580855, Y: 55.35154698315702, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.06561886658267, Y: 70.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.06561886658267, Y: 90.45060359574185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 211.06561886658267, Y: 110.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.06561886658267, Y: 130.4506035957418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.06561886658267, Y: 150.45060359574177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.74399601807193, Y: 166.62614002582455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.06561886658267, Y: 182.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.06561886658267, Y: 202.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 211.06561886658267, Y: 222.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.06561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.56561886658267, Y: 242.80167645590734, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 9.315618866582668, Y: 262.80167645590734, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 2.134551343810756, Y: 65.2813098156457, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 60.650081952571156, Y: 101.3620576380564, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 89.81561886658267, Y: 262.80167645590734, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 87.31561886658267, Y: 70.45060359574185, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 159.81561886658267, Y: 130.4506035957418, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 154.81561886658267, Y: 202.80167645590734, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 175.45516504702653, Y: 8.0407060084151, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 227.31561886658267, Y: 182.80167645590734, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 224.81561886658267, Y: 262.80167645590734, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'LMNA, -16.0 ± 1.0
 kcal/mol, AUC: 0.828', X: 50.657809433291334, Y: 275.60167645590735, Width: 142.5, Height: 23
Calculated bounding box: (2.134551343810756, 0.04070600841509986, 245.31561886658267, 275.60167645590735)
Updated viewBox: -2.865448656189244 -4.9592939915849 253.1810675227719 285.56097044749225
Updated SVG: /disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/final_image/LMNA_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/e2131597-7205-410c-96b9-7e148bc213c0/final_image/LMNA_fold_final_1.svg
