Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/final_image/MAVS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.69 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.69 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.69 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.30 MB
Based on canonical annotations, the following gene is in your area of interest: MAVS(+)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 170.30 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.16 seconds
write dat - Current memory usage: 173.69 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/fasta/MAVS.fasta" "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/ct/MAVS.ct" --SHAPE "MAVS.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.69 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/ct/MAVS.ct" "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/fold_FE/MAVS.txt" -sh "MAVS.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 173.69 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/ct/MAVS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/fold_dbn/MAVS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.69 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCUAGGCAACAGAGGGAGACCCUGUCUUUAAAGUACAUAGAGGUUUUUCACACCAACACAUCUCUGCCCAGUGUGCCAACAUCUGCC', '-structureDBN', '....((((.((((((((((((((((...........)))).)))))).............))))))....((((....)))).))))', '-o', '/disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/final_image/MAVS_fold_1.svg', '-title', 'MAVS, -19.9 ± 1.0\n kcal/mol, AUC: 0.784', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,6,12,14,15,16,18,23,24,25,27,28,29,33,34,38,40,42,43,44,45,46,47,48,61,63,65,66,71,72,73,74,75,82,84,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,1,2,37,7,13,17,19,20,21,22,86,87,26', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '68,69,70,8,9,11,76,80,83,41,49,50,51,52,57,59,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,4,10,77,78,79,81,30,31,32,35,36,39,53,54,55,56,58,60']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.34749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 172.84749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.34749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 207.84749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 225.34749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 225.34749412519267, Y: 178.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 225.34749412519267, Y: 158.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 225.34749412519267, Y: 138.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.80682928727214, Y: 127.12916199655447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 201.3271040054496, Y: 109.65657346983414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.69223728370054, Y: 105.85236411450799, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.05737056195147, Y: 102.04815475918184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.4225038402024, Y: 98.24394540385566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.78763711845335, Y: 94.43973604852948, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 103.15277039670428, Y: 90.6355266932033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.23642822971127, Y: 104.31316590925309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.30005639058743, Y: 122.61556741515184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 108.36368455146362, Y: 140.9179689210506, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.42731271233976, Y: 159.22037042694936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.49094087321595, Y: 177.52277193284812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.55456903409208, Y: 195.82517343874687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.15970287286564, Y: 211.32018914432211, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.3018384965966, Y: 225.46232476805307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 171.44397412032754, Y: 239.60446039178402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.5861097440585, Y: 253.74659601551497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 202.93817400004062, Y: 251.47613361626887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.53901924526753, Y: 257.01337756918895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.05358133537425, Y: 269.2459107959162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 237.96771917136203, Y: 285.71625102030316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.0932987305186, Y: 303.11555219768013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.80688592327664, Y: 317.9483425832959, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.9740955376609, Y: 327.2347553905378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.57479436028393, Y: 329.10917583138126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.10445413589693, Y: 323.1950379953935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.8719209091697, Y: 310.68047590528676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 160.3346769562496, Y: 294.0796306600599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.6051393554957, Y: 276.7275664040777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 148.46300373176476, Y: 262.58543078034677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.3208681080338, Y: 248.44329515661585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 120.17873248430286, Y: 234.3011595328849, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.79552038061468, Y: 225.51636503463584, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.8131665870066, Y: 208.9285692001706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 94.74953842613047, Y: 190.62616769427189, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 86.68591026525428, Y: 172.32376618837313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 78.62228210437814, Y: 154.02136468247437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 70.55865394350195, Y: 135.7189631765756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.49502578262582, Y: 117.41656167067686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 45.034554407198584, Y: 116.24100250675289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 28.930836600727787, Y: 109.39116507732751, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.973723119785632, Y: 97.62837585699441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 7.603334788988889, Y: 82.26001227489297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 64.9941940034659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 7.730853186755212, Y: 47.74993367490987, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 16.21458685891838, Y: 32.44384785979031, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.2582748354572, Y: 20.777134356378383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.41217395309326, Y: 14.046492240113594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 62.88085604394894, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.72276113830901, Y: 17.753970213681157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 94.06599251409224, Y: 27.780021964033722, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.31636901150966, Y: 41.96380783597891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.33461059910931, Y: 58.72886827036109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.96947732085837, Y: 62.53307762568727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 148.60434404260744, Y: 66.33728698101339, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 168.2392107643565, Y: 70.14149633633957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 187.87407748610556, Y: 73.94570569166575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 207.50894420785463, Y: 77.74991504699193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 220.19195251325908, Y: 65.6920835535168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 236.735045813106, Y: 59.984539066387526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 254.15498979517417, Y: 61.65652939578803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.310426693878, Y: 70.40654267631538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.46835981062947, Y: 84.65667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.46835981062947, Y: 84.65667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.46835981062947, Y: 84.65667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 339.46835981062947, Y: 84.65667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 356.6048044782207, Y: 81.10794494791588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 370.17599142475444, Y: 92.15666145522204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 370.17599142475444, Y: 109.656697215088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 356.6048044782207, Y: 120.7054137223941, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 339.46835981062947, Y: 117.15667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.46835981062947, Y: 117.15667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.46835981062947, Y: 117.15667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.46835981062947, Y: 117.15667933515499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.7373720227096, Y: 130.04655723267194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 257.84749412519267, Y: 138.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 257.84749412519267, Y: 158.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 257.84749412519267, Y: 178.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 257.84749412519267, Y: 198.7775450205918, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 156.09749412519267, Y: 218.7775450205918, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 187.35910297644244, Y: 126.84937588745089, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 139.0433423791147, Y: 169.45914377197198, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 251.2423729111839, Y: 309.6596331196821, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 101.03947135007414, Y: 247.07498596596741, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: -3.4997806699543936, Y: 109.98844982821444, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 118.50236700352838, Y: 33.11508046814231, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 279.0100386756446, Y: 55.604247667097354, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 315.71835981062947, Y: 137.156679335155, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 254.09749412519267, Y: 218.7775450205918, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MAVS, -19.9 ± 1.0
 kcal/mol, AUC: 0.784', X: 121.46299571237722, Y: 346.9091758313813, Width: 142.5, Height: 23
Calculated bounding box: (-3.4997806699543936, 5.0, 380.67599142475444, 346.9091758313813)
Updated viewBox: -8.499780669954394 0.0 394.17577209470886 351.9091758313813
Updated SVG: /disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/final_image/MAVS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/e4b6b8be-c2c1-46f0-8c64-0a02ad552941/final_image/MAVS_fold_final_1.svg
