Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 37% [===================                               ] \                     
 43% [======================                            ] |                     
 49% [=========================                         ] /                     
 55% [============================                      ] -                     
 61% [===============================                   ] \                     
 67% [==================================                ] |                     
 74% [======================================            ] /                     
 80% [=========================================         ] -                     
 86% [============================================      ] \                     
 92% [===============================================   ] |                     
 98% [==================================================] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.90 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.90 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.90 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.48 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.41 seconds
write fasta - Current memory usage: 171.48 MB
Length of region: 81 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 174.80 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 174.80 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 174.80 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.80 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAAAGAUGAAAAGAUUAAAAAGGACAAAGAACCCAAAGAAGAAGUUAAGAGCUUCAUGGAUCGAAAGAAGGGAUUUACAGA', '-structureDBN', '........................................(((((.....))))).((((((.........))))))....', '-o', '/disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -6.8 ± 0.5\n kcal/mol, AUC: 0.738', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '67,5,70,7,8,71,72,74,75,13,76,15,16,80,22,23,29,38,41,44,45,46,49,51,53,54,57,58,59,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '17', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,73,10,43,18,52,55,24,60,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,4,6,9,11,12,14,19,20,21,25,26,27,28,31,32,33,34,36,37,39,40,42,47,48,50,56,62,64,65,66,68,69,77,78,79,81']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 175.9591271574787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 424.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 442.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 459.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 477.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 494.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 529.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 547.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 564.75, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 582.25, Y: 175.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 599.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 617.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 634.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 652.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 669.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 687.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 704.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 704.75, Y: 155.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 704.75, Y: 135.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 704.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 704.75, Y: 95.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 698.1018303951821, Y: 79.77108685782412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 704.8280496512215, Y: 63.61532063157071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 721.0, Y: 56.92810673082627, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 737.1719503487785, Y: 63.61532063157071, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 743.8981696048179, Y: 79.77108685782412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 737.25, Y: 95.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 737.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 737.25, Y: 135.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 737.25, Y: 155.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 737.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 754.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 772.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 772.25, Y: 155.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 772.25, Y: 135.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 772.25, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 772.25, Y: 95.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 772.25, Y: 75.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 759.6722505002105, Y: 63.79155987339226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 754.925391537516, Y: 46.947664656414844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 759.2988797492502, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 771.6046824916709, Y: 17.56045199349532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 788.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 805.3953175083291, Y: 17.56045199349532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 817.7011202507498, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 822.074608462484, Y: 46.947664656414844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 817.3277494997895, Y: 63.79155987339226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 804.75, Y: 75.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 804.75, Y: 95.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 804.75, Y: 115.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 804.75, Y: 135.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 804.75, Y: 155.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 804.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 822.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 839.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 857.25, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 874.75, Y: 175.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 195.9591271574787, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 195.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 195.9591271574787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 195.95912715747872, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 683.5, Y: 195.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 760.1481113733449, Y: 79.72282449642785, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 748.5, Y: 115.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 838.323387503327, Y: 47.16865532485079, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 853.5, Y: 195.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '81', X: 871.0, Y: 195.95912715747875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -6.8 ± 0.5
 kcal/mol, AUC: 0.738', X: 373.75, Y: 208.75912715747876, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 889.0, 208.75912715747876)
Updated viewBox: -0.25 0.0 894.25 213.75912715747876
Updated SVG: /disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/e8cb3b8e-b04d-4f4f-a2d6-8b5008493c1e/final_image/CALD1_fold_final_1.svg
