Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 25% [=============                                     ] -                     
 30% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 51% [==========================                        ] \                     
 56% [=============================                     ] |                     
 61% [===============================                   ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 77% [=======================================           ] |                     
 82% [==========================================        ] /                     
 87% [============================================      ] -                     
 92% [===============================================   ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/final_image/TFRC_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.77 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.77 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.77 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.38 MB
Based on canonical annotations, the following gene is in your area of interest: TFRC(-)
write fasta - Elapsed time since the previous call: 0.61 seconds
write fasta - Current memory usage: 172.38 MB
Length of region: 97 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/fasta/TFRC.fasta" "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/ct/TFRC.ct" --SHAPE "TFRC.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 175.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/ct/TFRC.ct" "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/fold_FE/TFRC.txt" -sh "TFRC.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.95 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/ct/TFRC.ct" 1 "/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/fold_dbn/TFRC_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.95 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACACCUAUAAGGAACUGAUUGAGAGGAUUCCUGAGUUGAACAAAGUGGCACGAGCAGCUGCAGAGGUCGCUGGUCAGUUCGUGAUUAAACUAACCCA', '-structureDBN', '...........(((((((((.((..((((.((((((((................))))).))).)))).))))))))))).................', '-o', '/disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/final_image/TFRC_fold_1.svg', '-title', 'TFRC, -21.6 ± 1.0\n kcal/mol, AUC: 0.519', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '6,8,11,12,16,17,19,20,21,23,25,26,28,29,32,33,35,36,37,38,45,46,47,48,52,54,57,59,60,63,65,66,67,69,71,72,73,74,77,78,79,81,82,83,85,86,91', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,97,5,7,9,10,13,87,56,92,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,3,4,68,70,76,14,80,18,84,88,89,27,30,95,34,39,42,43,44,50,53,55,58,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,96,40,41,75,15,49,51,22,24,94,90,93,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 515.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 495.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 475.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 455.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 435.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 415.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 395.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 375.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 193.43438113341733, Y: 358.6654829164441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.15572209255677, Y: 344.8341735834417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.66734010780456, Y: 326.7357659528652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.13306463598636, Y: 309.3459311225235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.16958799280894, Y: 295.0620746559404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.05009103971588, Y: 290.6113473520769, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.19222666344683, Y: 276.4692117283459, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 266.3343622871778, Y: 262.32707610461495, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 280.47649791090873, Y: 248.184940480884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.19200363881095, Y: 232.0247832107031, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 303.3521609089919, Y: 225.30927748280084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.49429653272284, Y: 211.1671418590699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 331.6364321564538, Y: 197.02500623533894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.0151417908186, Y: 182.25021874937266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 347.79415691039003, Y: 163.43413642576928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 354.5731720299615, Y: 144.6180541021658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 361.35218714953294, Y: 125.80197177856229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 368.1312022691044, Y: 106.98588945495891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 356.2550994582802, Y: 94.13256503917881, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.2298841422628, Y: 78.1045858691727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.82654228453913, Y: 60.660950980167684, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.19908437811324, Y: 43.71602129160078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 361.86764348264865, Y: 29.129427057419207, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 375.771138475159, Y: 18.501981762156674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 392.3837229579975, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 409.88224007726575, Y: 13.227299663948088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 426.3463058341938, Y: 19.15893563238933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.9690626408616, Y: 30.143937384639457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 449.2554738600302, Y: 44.976750104385246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 453.18639739012974, Y: 62.029538929415196, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 451.330431953204, Y: 79.43083654791161, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 443.8912614558977, Y: 95.27092836653964, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 431.68530159159644, Y: 107.81143514663512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 416.0521018691681, Y: 115.67609235144818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 398.70733604496, Y: 118.00178902426256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 391.92832092538856, Y: 136.81787134786595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.1493058058171, Y: 155.63395367146944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 378.37029068624565, Y: 174.45003599507294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 371.59127556667414, Y: 193.26611831867632, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.39211321660815, Y: 210.62738800029962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.6174025450166, Y: 220.00597662390174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 340.47526692128565, Y: 234.1481122476327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 326.3331312975547, Y: 248.29024787136365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.6176255696525, Y: 264.45040514154454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 303.45746829947154, Y: 271.1659108694468, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.3153326757406, Y: 285.30804649317776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.17319705200964, Y: 299.4501821169087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 261.0310614282787, Y: 313.5923177406397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 256.5153691994616, Y: 330.5657173981599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 242.07725250749138, Y: 340.5671452276429, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.56563449224356, Y: 358.6655528582194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 375.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 395.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 415.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 435.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 455.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 475.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 495.7445145778791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 515.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 535.744514577879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 474.75, Y: 535.7445145778792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 492.25, Y: 535.7445145778792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 535.7445145778792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 535.7445145778792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 555.744514577879, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 555.744514577879, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 173.62066062619363, Y: 373.55091797389014, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 269.29986801507994, Y: 217.8826475869722, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 326.085331680389, Y: 82.98836870664877, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 469.40022661798884, Y: 60.82724006437394, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 382.52745948062335, Y: 221.3458338551942, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 257.9429513153581, Y: 344.4689858547135, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 240.14213562373095, Y: 549.8866502016101, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 401.0, Y: 555.744514577879, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '97', X: 523.5, Y: 555.7445145778792, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TFRC, -21.6 ± 1.0
 kcal/mol, AUC: 0.519', X: 200.0, Y: 568.5445145778791, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 541.5, 568.5445145778791)
Updated viewBox: -0.25 0.0 546.75 573.5445145778791
Updated SVG: /disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/final_image/TFRC_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/eb5826c4-920e-411e-9e9b-720edf0f42dd/final_image/TFRC_fold_final_1.svg
