Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 25% [=============                                     ] -                     
 30% [================                                  ] \                     
 35% [==================                                ] |                     
 40% [=====================                             ] /                     
 45% [=======================                           ] -                     
 50% [==========================                        ] \                     
 55% [============================                      ] |                     
 60% [===============================                   ] /                     
 65% [=================================                 ] -                     
 70% [====================================              ] \                     
 75% [======================================            ] |                     
 80% [=========================================         ] /                     
 85% [===========================================       ] -                     
 90% [==============================================    ] \                     
 95% [================================================  ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/final_image/RUNX1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.59 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.59 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.59 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.20 MB
Based on canonical annotations, the following gene is in your area of interest: RUNX1(-)
write fasta - Elapsed time since the previous call: 0.14 seconds
write fasta - Current memory usage: 172.20 MB
Length of region: 100 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/fasta/RUNX1.fasta" "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/ct/RUNX1.ct" --SHAPE "RUNX1.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 175.79 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/ct/RUNX1.ct" "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/fold_FE/RUNX1.txt" -sh "RUNX1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.79 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/ct/RUNX1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/fold_dbn/RUNX1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.79 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACACAUGCAGUAGCACUUUGGUAAGAGUUAAAGAGUAAAGCAGCUUAUGUUGUCAGGUCGUUCUUAUCUAGAGAAGAGCUAUAGCAGAUCUCGGACAAAC', '-structureDBN', '.....(((.(((((.((((((((((((.....((.....(((((....)))))....)).))))))))....)))).))))).)))..............', '-o', '/disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/final_image/RUNX1_fold_1.svg', '-title', 'RUNX1, -16.0 ± 1.7\n kcal/mol, AUC: 0.45', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '6,7,10,11,13,17,18,19,20,21,22,25,27,28,29,33,35,36,40,43,45,46,48,49,50,51,52,53,56,57,58,60,61,62,64,65,67,69,71,73,76,78,80,82,84,87,89,91,93,94', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,66,37,5,70,26', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '3,4,8,75,77,79,85,86,23,24,30,95,32,97,34,98,99,38,42,47,55', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,72,9,74,12,14,15,16,81,83,88,90,92,31,96,100,39,41,44,54,59,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 161.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 231.14113099242564, Y: 551.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.14113099242564, Y: 531.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.4627538409364, Y: 515.5849378799494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 231.14113099242564, Y: 499.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.14113099242564, Y: 479.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.14113099242564, Y: 459.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 231.14113099242564, Y: 439.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.14113099242564, Y: 419.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.4627538409364, Y: 403.2338650197839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.14113099242564, Y: 387.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.14113099242564, Y: 367.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.14113099242564, Y: 347.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.14113099242564, Y: 327.05832858970115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 220.7614418856487, Y: 312.9688717492135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 201.6602071678147, Y: 307.04073272805266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 182.55897244998067, Y: 301.1125937068916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.45773773214665, Y: 295.1844546857305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.3565030143126, Y: 289.2563156645695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 125.25526829647862, Y: 283.32817664340854, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 106.1540335786446, Y: 277.40003762224745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.05279886081058, Y: 271.47189860108637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 71.6572813474898, Y: 279.7922492970367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 54.16827761739103, Y: 279.1718109558937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.401065157122844, Y: 269.78140993358016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 31.4215259801652, Y: 254.20652149963092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 32.42668033680178, Y: 236.7354064829555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 42.13977734866506, Y: 222.1784170399182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 38.009742306706414, Y: 202.60949242582166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 21.962923801945635, Y: 195.70315166961808, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 10.180298312417221, Y: 182.80479272985184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 166.20028168605137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 6.634394292113143, Y: 148.83229432661955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.499526069899048, Y: 133.77881083182598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.774303683945277, Y: 123.70763161412486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.774303683945277, Y: 103.70763161412486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.774303683945277, Y: 83.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.774303683945277, Y: 63.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.774303683945277, Y: 43.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 26.225569296706226, Y: 26.57118694653377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.27428580401232, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 54.77432156387829, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 65.82303807118438, Y: 26.57118694653377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.27430368394528, Y: 43.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.27430368394528, Y: 63.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.27430368394528, Y: 83.70763161412492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.27430368394528, Y: 103.70763161412486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.27430368394528, Y: 123.70763161412486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 76.59487946350703, Y: 133.8286186169375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 85.45659188575638, Y: 148.9608134846565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.27704101247576, Y: 166.40212173680032, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 81.73115664860705, Y: 183.03811990919343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.80924480461329, Y: 195.89818548263878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.93927984657194, Y: 215.46711009673533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 88.70648678677856, Y: 224.85750940587621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 96.68602477019726, Y: 240.43239218460616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 115.78725948803128, Y: 246.36053120576713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 134.8884942058653, Y: 252.2886702269281, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 153.98972892369932, Y: 258.2168092480892, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 173.09096364153334, Y: 264.1449482692503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.19219835936735, Y: 270.07308729041125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.29343307720137, Y: 276.0012263115722, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 230.3946677950354, Y: 281.9293653327333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 246.92755865165185, Y: 276.19233474860636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.64114005936375, Y: 281.3794530745931, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.02081662557885, Y: 295.46889289244126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 274.02081315195096, Y: 312.9688928924408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 263.64113099242564, Y: 327.05832858970115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.64113099242564, Y: 347.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.64113099242564, Y: 367.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 263.64113099242564, Y: 387.0583285897011, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.3195081439149, Y: 403.2338650197839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 263.64113099242564, Y: 419.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 263.64113099242564, Y: 439.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.64113099242564, Y: 459.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.64113099242564, Y: 479.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.64113099242564, Y: 499.4094014498666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.3195081439149, Y: 515.5849378799494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 263.64113099242564, Y: 531.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 263.64113099242564, Y: 551.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 281.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 298.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 316.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 333.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 351.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 368.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 403.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 421.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 438.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 456.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 473.64113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 491.14113099242564, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 508.6411309924256, Y: 571.7604743100321, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 144.39113099242564, Y: 591.7604743100321, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 207.39113099242564, Y: 499.4094014498666, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 198.0108553926531, Y: 319.21208509829853, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 20.867315009111458, Y: 283.25140368120947, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 7.393345522248726, Y: 116.4352593755006, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 78.52430368394528, Y: 63.70763161412492, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 99.7402369347899, Y: 211.38751565824685, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 271.4857066181504, Y: 265.0832563921194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 279.89113099242564, Y: 459.4094014498666, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 329.89113099242564, Y: 591.7604743100321, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 500.3911309924256, Y: 591.7604743100321, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'RUNX1, -16.0 ± 1.7
 kcal/mol, AUC: 0.45', X: 195.1955654962128, Y: 604.5604743100321, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 527.3911309924256, 604.5604743100321)
Updated viewBox: -0.25 0.0 532.6411309924256 609.5604743100321
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/final_image/RUNX1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ebb002bf-4a6e-4d83-9336-cbe777310f93/final_image/RUNX1_fold_final_1.svg
