Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 44% [=======================                           ] |                     
 51% [==========================                        ] /                     
 57% [=============================                     ] -                     
 64% [=================================                 ] \                     
 70% [====================================              ] |                     
 76% [=======================================           ] /                     
 83% [==========================================        ] -                     
 89% [=============================================     ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/final_image/KPNB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.86 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.86 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.86 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.45 MB
Based on canonical annotations, the following gene is in your area of interest: KPNB1(+)
write fasta - Elapsed time since the previous call: 0.60 seconds
write fasta - Current memory usage: 172.45 MB
Length of region: 78 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/fasta/KPNB1.fasta" "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/ct/KPNB1.ct" --SHAPE "KPNB1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/ct/KPNB1.ct" "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/fold_FE/KPNB1.txt" -sh "KPNB1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.14 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/ct/KPNB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/fold_dbn/KPNB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.14 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAAGUAAACACAUACACACAAAACAGCAAACUUCAGGUAACUAUUUUGGAUUGCAAACAGGAUAAAUUAAAUGUUCA', '-structureDBN', '....(((......)))..........((((..((((((.......)))))))))).....(((((.......))))).', '-o', '/disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/final_image/KPNB1_fold_1.svg', '-title', 'KPNB1, -8.3 ± 1.0\n kcal/mol, AUC: 0.565', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,68,5,6,69,73,74,75,76,14,27,33,34,37,38,39,43,45,46,47,48,49,50,52,53,54,61,62', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,65,66,70,9,11,22,60,29,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '3,4,67,7,8,71,13,77,15,78,17,19,21,23,24,26,28,30,31,35,36,40,41,44,51,56', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '32,72,10,42,12,16,18,20,55,25,58,59,57']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 205.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 185.36669457570173, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.90309990849715, Y: 170.26763796311695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.8683050233931, Y: 153.02070459959788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 82.25001211687879, Y: 141.74333491144688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.74998788312121, Y: 141.74333491144688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.1316949766069, Y: 153.02070459959788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.09690009150285, Y: 170.267637963117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.25, Y: 185.36669457570173, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 205.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 225.36669457570176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 205.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 185.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 165.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.0716295660874, Y: 149.17360690015988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.77478317994087, Y: 132.9907625349246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.9473463047602, Y: 126.26284145229602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 330.0894819284911, Y: 112.12070582856506, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 344.2316175522221, Y: 97.97857020483411, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 358.373753175953, Y: 83.83643458110319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.515888799684, Y: 69.69429895737218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.65802442341493, Y: 55.55216333364123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 389.1921147249009, Y: 38.23660446964831, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 401.4620749077959, Y: 25.758693204590458, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 418.73260491798413, Y: 22.93398337955105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 434.33855340429324, Y: 30.85260474132562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 442.25717476606786, Y: 46.458553227634724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.43246494102846, Y: 63.72908323782295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 426.9545536759706, Y: 75.99904342071798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 409.63899481197774, Y: 78.53313372220398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 395.4968591882468, Y: 92.67526934593494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 381.35472356451584, Y: 106.81740496966592, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 367.2125879407849, Y: 120.95954059339687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 353.07045231705393, Y: 135.10167621712782, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 338.928316693323, Y: 149.24381184085883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 165.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 185.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 205.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 437.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 437.25, Y: 205.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 185.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 165.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 145.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.7979233435556, Y: 131.3308730466178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.6508797232032, Y: 113.83148532583743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 436.86561713592346, Y: 99.6220049687779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 453.5, Y: 94.18624382982026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 470.13438286407654, Y: 99.6220049687779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 480.3491202767968, Y: 113.83148532583743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 480.2020766564444, Y: 131.3308730466178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 145.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 469.75, Y: 165.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 185.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 205.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 469.75, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 487.25, Y: 225.36669457570179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 245.36669457570176, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 71.6395461804439, Y: 122.95679698837506, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 173.5, Y: 245.36669457570179, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 276.0000014649046, Y: 165.35903976148234, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 388.5126827721582, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 363.46258794078494, Y: 149.24381184085874, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 416.0, Y: 245.36669457570179, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 478.19440410534713, Y: 83.48126774023913, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '78', X: 483.5, Y: 245.36669457570179, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KPNB1, -8.3 ± 1.0
 kcal/mol, AUC: 0.565', X: 180.0, Y: 258.1666945757018, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 501.5, 258.1666945757018)
Updated viewBox: -0.25 -5.0 506.75 268.1666945757018
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/final_image/KPNB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ebc5513f-3244-4183-97f2-09826ff2b16e/final_image/KPNB1_fold_final_1.svg
