Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 62% [================================                  ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 78% [========================================          ] |                     
 83% [==========================================        ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.32 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.32 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.32 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.91 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 172.91 MB
Length of region: 96 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.14 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.14 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAUAUUUGCUCAAUAUGAUCUUGAUAUUCCUACAAAGAAAAAAGAAGGGGUAGGGAUUUGGCUAUGCCUUCACUACAACAUUAGAAUAUUGUAAC', '-structureDBN', '.......................(((((((.((...........(((((.((((........)))).)))))..........))))))))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -14.6 ± 0.7\n kcal/mol, AUC: 0.658', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,6,7,8,9,11,15,17,18,20,22,23,24,26,28,29,32,38,45,48,49,50,51,52,54,55,56,58,59,60,61,62,64,66,67,70,71,75,82,83,85,88,90,91,92,93', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '96,33,68,5,69,39,40', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,84,86,87,89,30,95,31,35,36,37,41,42,44,53,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '65,2,3,72,73,10,74,12,13,14,76,16,77,78,19,79,21,80,81,25,27,94,34,43,46,47,57']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 144.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 389.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 407.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 481.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 461.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 441.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 421.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 401.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 407.25, Y: 381.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 403.43438113341733, Y: 364.0721188407106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 414.1557220925568, Y: 350.2408095077082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.66734010780453, Y: 332.14240187713176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 410.1844673504159, Y: 319.8775089530277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 400.9006567402035, Y: 305.04307026224467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 395.3263005050432, Y: 288.45463262392497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 393.7678577291723, Y: 271.024171734114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 396.31100627847906, Y: 253.70995485395883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.81593252379787, Y: 237.46385854561885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 412.92501781714964, Y: 223.1790377470008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.0824991446935, Y: 211.64082316101616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 441.5650230807772, Y: 203.48354645334672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 458.52141329095616, Y: 199.155666862018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 476.0194653023615, Y: 198.89511643878535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 493.09719592462466, Y: 202.71621935683282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 503.6718833569305, Y: 185.74047237152962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 514.2465707892364, Y: 168.76472538622642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 524.8212582215424, Y: 151.7889784009232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 535.3959456538483, Y: 134.81323141562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 538.2799644601731, Y: 117.55258728268012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 552.5009916033472, Y: 107.35406840235595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 563.0756195406209, Y: 90.37828435600846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 573.6502474778947, Y: 73.40250030966087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 584.2248754151685, Y: 56.42671626331338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 581.2342995109772, Y: 39.18412467111051, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 588.1002811411049, Y: 23.08726767016219, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 602.6152974563815, Y: 13.31154210008367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 620.112538683904, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 634.9663620695883, Y: 22.25280713519578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 642.4010259514475, Y: 38.09503810239261, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 640.0261670457977, Y: 55.43316240211112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 628.605340453744, Y: 68.69269591609537, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 611.8105244904834, Y: 73.61048666138328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 601.2358965532096, Y: 90.58627070773076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 590.6612686159358, Y: 107.56205475407836, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 580.086640678662, Y: 124.53783880042585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 577.2026398784418, Y: 141.79856124719294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 562.9815345049661, Y: 151.9970984931171, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 552.4068470726602, Y: 168.9728454784203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 541.8321596403542, Y: 185.94859246372351, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 531.2574722080483, Y: 202.92433944902672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 520.6827847757423, Y: 219.90008643432992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 531.6417102587479, Y: 233.54383783407076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 539.1223898411087, Y: 249.36437616201812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.7135608974945, Y: 266.4919413843075, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.2177929110123, Y: 283.98491752056225, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 537.6623415395778, Y: 300.88159952628445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 529.297650191434, Y: 316.2530646044833, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 517.5835814881564, Y: 329.25424125949775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 503.1641355630438, Y: 339.1703684880458, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 486.8320450978898, Y: 345.4562909372991, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.48519354404067, Y: 347.76642971423894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 452.0772525074914, Y: 345.9737811519094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 443.5656344922436, Y: 364.0721887824859, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 381.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 401.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 421.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 441.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 461.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 481.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 457.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 527.25, Y: 501.1511505021456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 521.1511505021456, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 521.1511505021456, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 521.1511505021456, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 383.6206606261936, Y: 378.95755389815656, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 394.31652871858637, Y: 209.79153231440148, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 517.5541989443217, Y: 106.97792959787404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 658.4224604932748, Y: 35.08001303479523, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 555.0579066256574, Y: 196.5232798960294, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 508.73673698501705, Y: 356.8646925137616, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 456.0, Y: 481.1511505021456, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '96', X: 523.5, Y: 521.1511505021456, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -14.6 ± 0.7
 kcal/mol, AUC: 0.658', X: 257.57551297572377, Y: 533.9511505021455, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 676.4224604932748, 533.9511505021455)
Updated viewBox: -0.25 0.0 681.6724604932748 538.9511505021455
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ec20491a-dd30-40ec-97e7-953d5c1d25e5/final_image/CLOCK_fold_final_1.svg
