Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 45% [=======================                           ] |                     
 51% [==========================                        ] /                     
 58% [==============================                    ] -                     
 64% [=================================                 ] \                     
 71% [====================================              ] |                     
 77% [=======================================           ] /                     
 84% [===========================================       ] -                     
 90% [==============================================    ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/final_image/ATP13A3_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.39 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.39 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.39 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.98 MB
Based on canonical annotations, the following gene is in your area of interest: ATP13A3(-)
write fasta - Elapsed time since the previous call: 0.61 seconds
write fasta - Current memory usage: 171.98 MB
Length of region: 77 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.51 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/fasta/ATP13A3.fasta" "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/ct/ATP13A3.ct" --SHAPE "ATP13A3.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.51 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/ct/ATP13A3.ct" "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/fold_FE/ATP13A3.txt" -sh "ATP13A3.dat"

efn2 - Elapsed time since the previous call: 0.53 seconds
efn2 - Current memory usage: 175.51 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/ct/ATP13A3.ct" 1 "/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/fold_dbn/ATP13A3_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.03 seconds
ct2dot - Current memory usage: 175.51 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAAUAUAUCGUCCUAACAGUUAAAUUAACAAUCAAUCCAUAAAGUCCUAUAUCUUCAUUCAGCAACCCAAAUAUUA', '-structureDBN', '...................((((...))))...............................................', '-o', '/disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/final_image/ATP13A3_fold_1.svg', '-title', 'ATP13A3, -0.7 ± 0.2\n kcal/mol, AUC: 0.69', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,7,9,73,11,12,75,76,15,20,21,22,26,27,33,37,41,45,46,49,51,53,55,56,59,60,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '2,66,68,69,70,23,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,3,4,67,6,72,13,77,16,24,25,28,29,31,32,35,39,40,42,44,48,52', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,71,8,10,74,17,18,19,30,34,36,38,43,47,50,54,57,58,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 98.95182584542651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 98.95182584542651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 98.95182584542651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 98.95182584542651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 337.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 58.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 38.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 338.19020113855714, Y: 21.477077958505078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 353.5, Y: 12.999999999999986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.80979886144286, Y: 21.477077958505078, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 38.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 58.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 98.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 492.25, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 98.95182584542654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 527.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 562.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 579.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 597.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 614.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 632.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 649.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 667.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 684.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 702.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 719.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 737.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 754.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 772.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 789.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 807.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 824.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 842.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 859.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 877.25, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 894.75, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 912.25, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 929.75, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 947.25, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 964.75, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 982.25, Y: 98.95182584542657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 999.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1017.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1034.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1052.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1069.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1087.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1104.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1122.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1139.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1157.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1174.75, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1192.25, Y: 98.95182584542658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 118.95182584542651, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 118.95182584542653, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 319.35786437626905, Y: 113.09396146915748, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 380.14213562373095, Y: 113.09396146915748, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 541.0, Y: 118.95182584542655, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 716.0, Y: 118.95182584542655, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 891.0, Y: 118.95182584542657, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 1066.0, Y: 118.95182584542658, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '77', X: 1188.5, Y: 118.95182584542658, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ATP13A3, -0.7 ± 0.2
 kcal/mol, AUC: 0.69', X: 537.0, Y: 131.7518258454266, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 4.999999999999986, 1206.5, 131.7518258454266)
Updated viewBox: -0.25 -1.4210854715202004e-14 1211.75 136.7518258454266
Updated SVG: /disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/final_image/ATP13A3_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/edce6b78-b961-427f-8ccb-62feb71ee281/final_image/ATP13A3_fold_final_1.svg
