Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 44% [=======================                           ] |                     
 51% [==========================                        ] /                     
 57% [=============================                     ] -                     
 64% [=================================                 ] \                     
 70% [====================================              ] |                     
 76% [=======================================           ] /                     
 83% [==========================================        ] -                     
 89% [=============================================     ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.99 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.99 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.99 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.55 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.32 seconds
write fasta - Current memory usage: 172.55 MB
Length of region: 78 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.21 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.21 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGUGGAAUGAAUACUGGACACAUUGGCACAACUCAGCACAUGAUACAACAACAGACUUUACAGAGUACAUCAACUCA', '-structureDBN', '..(((..(((....((((...............))))..)))..)))................((((......)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -10.3 ± 0.8\n kcal/mol, AUC: 0.671', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,66,3,4,5,6,67,71,9,10,76,13,16,17,18,24,25,26,27,34,37,42,43,45,55,58,59,60', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,65,7,75,77,15,19,28,32,33,36,38,41,46,50,51,53,56,57', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,70,8,72,74,11,12,78,20,23,30,35,39,40,48,49,52,54', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,69,73,44,14,47,63,61,21,22,29,62,31']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 314.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 294.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.37031668259823, Y: 280.7253945897724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.37031668259823, Y: 263.2253910659015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 249.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 229.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 209.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 27.24021242970585, Y: 196.8984909482444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.648907661438386, Y: 180.01150913464687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 27.240217697477732, Y: 163.1245287532746, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.750009085158865, Y: 150.88707175908723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 56.73393899968946, Y: 146.66849867020971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 66.86073778484717, Y: 129.42181938505666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 76.98753657000489, Y: 112.17514009990362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.11433535516261, Y: 94.92846081475051, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.21343809456809, Y: 79.86112427752437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 75.04240217237384, Y: 62.650803724151615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 77.98872680984894, Y: 45.400592899344474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 86.6923724077455, Y: 30.21846012176991, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.08975722995574, Y: 18.959655465177775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.54372663268848, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.04361265544543, Y: 13.067761052262199, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 150.45093677811442, Y: 19.15465825061972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.76073107329188, Y: 30.516875384161608, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 172.3465444217912, Y: 45.765954422399204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 175.15919413753193, Y: 63.038464487419674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 171.8549756390163, Y: 80.22371230302463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.83766300086643, Y: 95.2216680022375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.2091679361498, Y: 106.19958787080475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.63488666055898, Y: 111.8159748381787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 115.14018919353634, Y: 111.38450884063178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 105.01339040837864, Y: 128.6311881257849, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 94.88659162322092, Y: 145.87786741093794, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 84.7597928380632, Y: 163.124546696091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.35109233856087, Y: 180.011523006157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 84.75978405844648, Y: 196.89849692918278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.25, Y: 209.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.25, Y: 229.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 249.13595184477037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.62968331740177, Y: 263.2253910659015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.62968331740177, Y: 280.7253945897724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 294.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.25, Y: 314.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 334.81483381090345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 314.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 294.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 274.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.90309990849715, Y: 259.71577719831873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.86830502339313, Y: 242.46884383479966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 377.2500121168788, Y: 231.1914741466486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 394.7499878831212, Y: 231.1914741466486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 408.1316949766069, Y: 242.46884383479966, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 411.09690009150285, Y: 259.71577719831873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.25, Y: 274.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 294.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 314.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 334.8148338109035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 354.81483381090345, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 16.700600003206326, Y: 214.38315679252688, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 51.29282737112051, Y: 62.781217561886876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 186.78287642281305, Y: 87.37465785663113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 87.79939945118427, Y: 214.38315879929658, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 121.0, Y: 354.81483381090345, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 296.0, Y: 354.8148338109035, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 366.6395461804439, Y: 212.40493622357675, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '78', X: 416.0, Y: 354.8148338109035, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -10.3 ± 0.8
 kcal/mol, AUC: 0.671', X: 146.25, Y: 367.6148338109035, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 434.0, 367.6148338109035)
Updated viewBox: -0.25 0.0 439.25 372.6148338109035
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ef7ea549-aaab-4a3f-b032-11362b72d940/final_image/CLOCK_fold_final_1.svg
