Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 54% [============================                      ] \                     
 59% [==============================                    ] |                     
 65% [=================================                 ] /                     
 70% [====================================              ] -                     
 76% [=======================================           ] \                     
 81% [=========================================         ] |                     
 86% [============================================      ] /                     
 92% [===============================================   ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/final_image/IQGAP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.96 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.96 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.96 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.61 MB
Based on canonical annotations, the following gene is in your area of interest: IQGAP1(+)
write fasta - Elapsed time since the previous call: 0.67 seconds
write fasta - Current memory usage: 172.61 MB
Length of region: 92 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.07 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/fasta/IQGAP1.fasta" "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/ct/IQGAP1.ct" --SHAPE "IQGAP1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.07 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/ct/IQGAP1.ct" "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/fold_FE/IQGAP1.txt" -sh "IQGAP1.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.07 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/ct/IQGAP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/fold_dbn/IQGAP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.07 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUGAUCGAAAGAACAUGCCAAGAUGUAUCUACUGUAUCCAUGCACUCAGUUUGUACCUGUUCAAGCUAGGCCUGGCCCCUCAGAUUCAAGAC', '-structureDBN', '.........(((((((......)))).))).(((...(((.((.((.((((((........)))))))))).))).....))).........', '-o', '/disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/final_image/IQGAP1_fold_1.svg', '-title', 'IQGAP1, -17.1 ± 0.8\n kcal/mol, AUC: 0.545', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,7,11,16,17,22,24,25,26,28,30,33,34,35,37,41,42,46,49,50,51,52,53,54,58,59,60,61,65,67,69,70,73,74,75,80,83,85,86,90', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '68,71,40,72,43,76,77,78,48,19,91,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,4,8,9,12,13,15,79,82,20,23,27,92,29,44,45,47,57,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,66,6,10,14,81,18,84,21,87,88,89,31,32,36,38,39,55,56']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 395.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 375.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 158.43439675932206, Y: 358.3212543536837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 149.9229049137529, Y: 340.22278738648424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.41141306818372, Y: 322.1243204192848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 132.89992122261455, Y: 304.02585345208536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 118.46837990751553, Y: 294.12738048451797, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.8118066144279, Y: 277.2583118384671, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 121.12186379722903, Y: 261.3582421592723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.95800046383548, Y: 253.91069710767079, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 153.86678166065326, Y: 258.4209377062657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.8899216360324, Y: 272.7661744367289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.30993004431363, Y: 290.19467920303543, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 170.8214218898828, Y: 308.2931461702349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.33291373545197, Y: 326.3916131374343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 187.84440558102114, Y: 344.49008010463376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.56563449224356, Y: 358.3213942371798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 375.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 395.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 415.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 395.40035595683946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 375.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.92691721038744, Y: 364.6685095326053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.2313747176388, Y: 348.95136057918086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.2313776065814, Y: 331.45135642255786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 215.92692528857876, Y: 315.7342100099314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 207.13202463684215, Y: 297.7717568777425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.33712398510553, Y: 279.8093037455536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.22602802977954, Y: 268.2185072582772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.11087452524674, Y: 250.7541483229898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.31591092048404, Y: 232.79172601443406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 164.3414710917783, Y: 218.97336395402715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 168.12124766199497, Y: 201.73681126314318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 168.12124766199497, Y: 181.73681126314318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.3056287954123, Y: 164.65777960170823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 175.02696975455177, Y: 150.82647026870586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 183.53858776979956, Y: 132.72806263812936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.05020578504738, Y: 114.62965500755286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 200.5618238002952, Y: 96.53124737697635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.07344181554302, Y: 78.43283974639985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 217.58505983079084, Y: 60.33443211582335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.59373285712644, Y: 43.56132375463392, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.52531484171706, Y: 26.770552236222557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 230.79422334347805, Y: 15.360619010031883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.1342921710147, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.9704120092937, Y: 20.44767195316092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.2110171844712, Y: 35.3090892829689, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 272.88510541846705, Y: 52.806068753009185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.09746255386364, Y: 67.31305176841295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 246.99497223047763, Y: 74.165811390601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.48335421522984, Y: 92.2642190211775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.971736199982, Y: 110.362626651754, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.46011818473417, Y: 128.4610342823305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.94850016948635, Y: 146.559441912907, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 204.43688215423853, Y: 164.6578495434835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.62124766199497, Y: 181.73681126314318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 200.62124766199497, Y: 201.73681126314318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 204.50484717188704, Y: 218.49991015669468, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 213.29981077664976, Y: 236.46233246525043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.41098269112607, Y: 248.05315517242042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.52611032491248, Y: 265.5175901864816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 236.32101097664906, Y: 283.4800433186705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 245.11591162838567, Y: 301.4424964508594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.2500077476446, Y: 305.0023770915549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 276.07308548234226, Y: 315.7342232486942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 283.7686252823612, Y: 331.45136889242747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 283.7686233563999, Y: 348.95136889242735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 276.0730800968825, Y: 364.66851284229614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 375.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 395.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.75, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 384.75, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 402.25, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.75, Y: 415.4003559568395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 435.40035595683946, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 429.5424915805704, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 131.42112305340856, Y: 233.99068031249448, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 205.14213562373095, Y: 429.5424915805704, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 176.62467855880422, Y: 288.60422013555683, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 170.2017981544709, Y: 106.11803699230506, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 288.2055537084222, Y: 58.832510656831516, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 218.71726948044272, Y: 209.70494655193193, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 287.83708298224667, Y: 377.29054574008694, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 381.0, Y: 435.4003559568395, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '92', X: 416.0, Y: 435.4003559568395, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'IQGAP1, -17.1 ± 0.8
 kcal/mol, AUC: 0.545', X: 146.25, Y: 448.20035595683953, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 434.0, 448.20035595683953)
Updated viewBox: -0.25 0.0 439.25 453.20035595683953
Updated SVG: /disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/final_image/IQGAP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/efa710b6-ad39-4514-b423-aedd207444fc/final_image/IQGAP1_fold_final_1.svg
