Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 21% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 37% [===================                               ] |                     
 42% [======================                            ] /                     
 47% [========================                          ] -                     
 53% [===========================                       ] \                     
 58% [==============================                    ] |                     
 63% [================================                  ] /                     
 69% [===================================               ] -                     
 74% [======================================            ] \                     
 79% [========================================          ] |                     
 85% [===========================================       ] /                     
 90% [==============================================    ] -                     
 95% [================================================  ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.86 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.86 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.86 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.48 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.68 seconds
write fasta - Current memory usage: 172.48 MB
Length of region: 94 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.06 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.06 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.06 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.06 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGUCUGUUGGUUCAUCAUUAACACAGCCAGUGAUGUCUCAAGCUACAAAUUUACCAAUUCCACAAGGCAUGUCCCAGUUUCAGUUUUCAGCUC', '-structureDBN', '..((((..(((..(((((((.........)))))))........................)))..)))).........................', '-o', '/disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -9.2 ± 0.9\n kcal/mol, AUC: 0.636', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,6,7,8,9,10,11,12,13,16,19,20,27,31,32,33,35,36,37,39,43,45,51,52,53,59,60,67,68,71,72,73,78,79,80,81,84,85,86,87,88,91,93', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '48,17,2,70,74,75,92', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '5,69,14,18,82,83,22,28,29,30,94,34,38,40,49,56,57,61,62,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,65,66,76,77,15,21,23,24,25,26,89,90,41,42,44,46,47,50,54,55,58']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 181.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.070846057526, Y: 314.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.070846057526, Y: 294.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.070846057526, Y: 274.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.69116274012424, Y: 260.11202227950514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.69116274012424, Y: 242.61201875563424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 216.070846057526, Y: 228.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.070846057526, Y: 208.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.070846057526, Y: 188.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 199.27031771280463, Y: 183.625278602748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 183.76155702292175, Y: 175.5185128517288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.15071815330748, Y: 164.51913221719522, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 153.72891139183082, Y: 175.93509747155363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.3071046303541, Y: 187.35106272591204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 120.88529786887739, Y: 198.76702798027046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.46349110740073, Y: 210.18299323462887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 88.04168434592401, Y: 221.59895848898728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 71.61987758444735, Y: 233.0149237433457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.80856321300172, Y: 250.28761859959585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.687702444086426, Y: 263.79968475731687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 41.27821244504008, Y: 269.8806480085975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.037635763643834, Y: 266.87865004305445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 10.649274812713372, Y: 255.60916615337138, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 239.13348611349707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 7.942315027949917, Y: 221.92713261095176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 19.359046080445978, Y: 208.66411153100168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 35.89890454790714, Y: 202.94724543421583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.06893404611492, Y: 206.32948775594608, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 69.49074080759164, Y: 194.91352250158766, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 85.9125475690683, Y: 183.49755724722925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.33435433054501, Y: 172.08159199287084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.75616109202167, Y: 160.66562673851243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.1779678534984, Y: 149.24966148415402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 151.5997746149751, Y: 137.83369622979555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 146.03113306958005, Y: 121.24333061179604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.83518869736946, Y: 103.88165361001546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 145.09777160624571, Y: 86.42725919490579, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 149.7695328105624, Y: 69.56236526550788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.66787307268163, Y: 53.946148658922766, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 168.48407992906073, Y: 40.18898073670789, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 181.79539394493156, Y: 28.828570569338012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.0815325790951, Y: 20.308948179987055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 213.74502581137017, Y: 14.963109303073225, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.13456869967484, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.57047811479822, Y: 14.496349848000364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.37125865757855, Y: 19.393672907931887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.88023940999034, Y: 27.500553690410356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.49124040305026, Y: 38.50012877160884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.67226560868113, Y: 51.96247163424039, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 313.98629639744786, Y: 67.36139666306747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.10837273450886, Y: 84.09502549835952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 320.8382944826211, Y: 101.50931189618268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.1084463723897, Y: 118.9236056089787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 313.9864407950186, Y: 135.65725610327857, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 305.6724751220561, Y: 151.0562162885897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.4915068432442, Y: 164.51860643106474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 280.8805523629917, Y: 175.51823906749817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 265.37160589138796, Y: 183.6251854310144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.570846057526, Y: 188.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.570846057526, Y: 208.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 248.570846057526, Y: 228.52257953450314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.9505293749278, Y: 242.61201875563424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.9505293749278, Y: 260.11202227950514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 248.570846057526, Y: 274.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 248.570846057526, Y: 294.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 248.570846057526, Y: 314.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 283.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 301.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 318.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 336.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 353.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 371.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.570846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 406.070846057526, Y: 334.20146150063624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 423.570846057526, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 441.070846057526, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 458.570846057526, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 476.070846057526, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 493.57084605752607, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 511.07084605752607, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 528.5708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 546.0708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 563.5708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 581.0708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 598.5708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 616.0708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 633.5708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 651.0708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 668.5708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 686.0708460575261, Y: 334.2014615006363, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 181.820846057526, Y: 354.20146150063624, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 192.320846057526, Y: 208.52257953450314, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 83.24179797416483, Y: 245.8096126231969, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 42.68103225461765, Y: 187.46316167463291, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 127.36754617616788, Y: 62.34409714979148, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 304.7882775582152, Y: 24.263529909471288, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 269.0892318615957, Y: 202.17874472213367, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 262.320846057526, Y: 354.20146150063624, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 437.320846057526, Y: 354.2014615006363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 612.3208460575261, Y: 354.2014615006363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '94', X: 682.3208460575261, Y: 354.2014615006363, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -9.2 ± 0.9
 kcal/mol, AUC: 0.636', X: 279.41042302876303, Y: 367.0014615006363, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 700.3208460575261, 367.0014615006363)
Updated viewBox: -0.25 0.0 705.5708460575261 372.0014615006363
Updated SVG: /disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/f03f4b48-1752-44c1-b3e2-87e7201f4767/final_image/CLOCK_fold_final_1.svg
