Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/final_image/ZMIZ1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.77 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.77 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.77 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.33 MB
Based on canonical annotations, the following gene is in your area of interest: ZMIZ1(+)
write fasta - Elapsed time since the previous call: 0.44 seconds
write fasta - Current memory usage: 172.33 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.83 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/fasta/ZMIZ1.fasta" "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/ct/ZMIZ1.ct" --SHAPE "ZMIZ1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.83 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/ct/ZMIZ1.ct" "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/fold_FE/ZMIZ1.txt" -sh "ZMIZ1.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 175.83 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/ct/ZMIZ1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/fold_dbn/ZMIZ1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.83 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACCGGCAGAUGAACACCAACUGGCCCGCCUCGGUGCAGGUCAGCGUGAACGCCACGCCCCUCACCAUUGAGCGCGGCGACAA', '-structureDBN', '.....(((.((.....)).)))((((((.((((((.(((...(((((.....))))).)))))))...))))).))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/final_image/ZMIZ1_fold_1.svg', '-title', 'ZMIZ1, -32.8 ± 1.1\n kcal/mol, AUC: 0.758', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,8,10,11,21,22,23,27,30,32,33,34,35,38,39,40,43,45,46,47,51,56,61,67,68,69,71,73,75,76,78', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,58,72,13,77,17,55,24,25,26,59,28,29,57', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,2,3,36,37,70,42,74,44,20,53,54,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,66,6,7,9,12,14,15,16,79,18,19,80,81,82,41,48,49,50,52,60,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.020753972260565, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 46.520753972260565, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 64.02075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 81.52075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 99.02075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 116.52075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.52075397226056, Y: 420.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 116.52075397226056, Y: 400.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.8423768207713, Y: 384.70277431533873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.52075397226054, Y: 368.527237885256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 116.52075397226056, Y: 348.527237885256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.87258436744264, Y: 332.33919758560137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.59880362348207, Y: 316.1834313593479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.77075397226056, Y: 309.4962174586035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 148.94270432103906, Y: 316.1834313593479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.6689235770785, Y: 332.33919758560137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 149.02075397226056, Y: 348.527237885256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.02075397226056, Y: 368.527237885256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.69913112374982, Y: 384.70277431533873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 149.02075397226056, Y: 400.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 149.02075397226056, Y: 420.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.02075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.52075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.52075397226056, Y: 420.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.52075397226056, Y: 400.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.70515073158262, Y: 383.7992091422657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 154.19365888601345, Y: 365.70074217506624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.68216704044428, Y: 347.6022752078668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 134.96093812922183, Y: 333.77096107532077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.7765726214654, Y: 316.691999355661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 138.7765726214654, Y: 296.691999355661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 129.97945585592834, Y: 281.56402584130683, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 112.59695278315081, Y: 271.67218137604755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 95.21444971037327, Y: 261.7803369107884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 77.83194663759575, Y: 251.88849244552912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.1009552025006, Y: 246.7575865385675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 54.38250821476912, Y: 230.59854139659322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 42.86250697995183, Y: 214.24954841384937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 31.34250574513456, Y: 197.90055543110543, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 14.861034923557781, Y: 192.449805989462, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 178.33894057685677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.887402601798584, Y: 160.9800618560672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 15.220543127240774, Y: 147.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 15.220543127240774, Y: 127.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 15.220543127240774, Y: 107.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 15.220543127240774, Y: 87.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 15.220543127240774, Y: 67.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 8.57237352242285, Y: 50.84298012699787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 15.298592778462279, Y: 34.68721390074438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 31.470543127240745, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 47.64249347601924, Y: 34.68721390074438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.36871273205867, Y: 50.84298012699787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.72054312724076, Y: 67.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 47.720543127240774, Y: 87.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.720543127240774, Y: 107.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 47.720543127240774, Y: 127.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.720543127240774, Y: 147.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.19108625448155, Y: 161.4019822425813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.909619342093336, Y: 179.18055342452737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 69.42962057691062, Y: 195.52954640727125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 80.9496218117279, Y: 211.8785393900152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 93.90619389364203, Y: 223.64192495226567, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.28869696641954, Y: 233.5337694175249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.67120003919706, Y: 243.42561388278412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 146.05370311197458, Y: 253.3174583480434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.55293871077848, Y: 253.15389350599403, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.01695367658473, Y: 264.33290513495956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 180.07371678015625, Y: 281.5638714261645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 171.2765726214654, Y: 296.691999355661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.2765726214654, Y: 316.691999355661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 175.09217586214336, Y: 333.7711009588169, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 183.60366770771253, Y: 351.8695679260163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.1151595532817, Y: 369.96803489321576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 202.83638846450413, Y: 383.7993490257618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 199.02075397226056, Y: 400.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 199.02075397226056, Y: 420.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 199.02075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.52075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 234.02075397226056, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 251.52075397226054, Y: 440.87831074542146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.02075397226054, Y: 440.8783107454215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 286.52075397226054, Y: 440.8783107454215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 29.770753972260565, Y: 460.87831074542146, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 92.77075397226054, Y: 368.527237885256, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 165.27075397226056, Y: 400.87831074542146, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 115.14722942463291, Y: 318.88556131342517, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: -0.7400383640340209, Y: 208.56042552851534, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 27.720543127240724, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 82.02861355965447, Y: 184.00954517245395, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 183.3337460637486, Y: 304.43911121589673, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 247.77075397226054, Y: 460.87831074542146, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 282.77075397226054, Y: 460.8783107454215, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ZMIZ1, -32.8 ± 1.1
 kcal/mol, AUC: 0.758', X: 79.63537698613027, Y: 473.6783107454215, Width: 142.5, Height: 23
Calculated bounding box: (-0.7400383640340209, 0.0, 300.77075397226054, 473.6783107454215)
Updated viewBox: -5.740038364034021 -5.0 311.51079233629457 483.6783107454215
Updated SVG: /disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/final_image/ZMIZ1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/f3b641db-0c23-4f26-813d-e4c537426c85/final_image/ZMIZ1_fold_final_1.svg
