Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/final_image/SUGP2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.21 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.21 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.21 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.95 MB
Based on canonical annotations, the following gene is in your area of interest: SUGP2(-)
write fasta - Elapsed time since the previous call: 0.51 seconds
write fasta - Current memory usage: 172.95 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.62 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/fasta/SUGP2.fasta" "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/ct/SUGP2.ct" --SHAPE "SUGP2.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.62 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/ct/SUGP2.ct" "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/fold_FE/SUGP2.txt" -sh "SUGP2.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.62 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/ct/SUGP2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/fold_dbn/SUGP2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.62 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAUAAUCAAAUGGGCAGGAUUCCACACCAUAAAAGAUGAUAUUAAAUUUUCCCAACUUUUCCAGACUCUCUUUGAACUUGAAAC', '-structureDBN', '...........((((.((((((......(((.....)))......)))))))))).......((((.....))))..........', '-o', '/disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/final_image/SUGP2_fold_1.svg', '-title', 'SUGP2, -5.2 ± 0.8\n kcal/mol, AUC: 0.681', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,7,12,13,14,15,18,19,21,22,31,36,38,39,41,43,44,48,49,50,51,58,59,60,61,65,68,70,72,73,74,75,79,80,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,45,54,9,77', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,34,67,16,17,52,53,84,24,25,62,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,5,6,8,10,11,20,23,26,27,28,29,30,32,33,35,37,40,42,46,47,55,56,57,69,71,76,78,82,83,85']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 324.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 304.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 284.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.43438113341733, Y: 267.8288478033058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.15572209255677, Y: 253.99753847030337, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.66734010780456, Y: 235.89913083972692, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.17895812305235, Y: 217.80072320915042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.69057613830014, Y: 199.70231557857397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 238.2021941535479, Y: 181.60390794799747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 246.7138121687957, Y: 163.50550031742097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 236.52432004020335, Y: 149.27792252546993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.89363517251007, Y: 132.4017121297448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.39506474188704, Y: 114.96624744098864, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 240.84272256276267, Y: 99.13014588006735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 253.31454293721742, Y: 86.8540139073325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 269.26643804133613, Y: 79.65771192285058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 286.7234654642186, Y: 78.43218623099699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 295.23507311662513, Y: 60.333773726815934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.7466807690316, Y: 42.23536122263499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 304.6199273583442, Y: 24.757139109618947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.58219906490604, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 335.06247753591515, Y: 13.83106703318174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 346.8508619058387, Y: 26.764929634300074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 346.0619792682136, Y: 44.2471626730661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.1566010883257, Y: 56.06672365779559, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 324.6449934359192, Y: 74.16513616197653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 316.1333857835127, Y: 92.26354866615765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.32288955842984, Y: 106.4911279690802, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 330.9535820672784, Y: 123.36734457377253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.4521546630696, Y: 140.80281748820454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.00449343347054, Y: 156.63892629716162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 309.53266534246393, Y: 168.91506184823714, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.5807605827516, Y: 176.11136190709163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 276.12372456848254, Y: 177.3368795921986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.61210655323475, Y: 195.43528722277512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 259.10048853798696, Y: 213.53369485335162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 250.58887052273917, Y: 231.63210248392812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 242.07725250749138, Y: 249.73051011450457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.56563449224356, Y: 267.82891774508107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 284.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 304.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 324.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 344.90787946474074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 324.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 304.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 284.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.1018303951821, Y: 268.71983916508617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.82804965122153, Y: 252.5640729388328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 386.0, Y: 245.8768590380883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.17195034877847, Y: 252.5640729388328, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 408.8981696048179, Y: 268.71983916508617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 284.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 304.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 324.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 489.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 559.75, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 577.25, Y: 344.9078794647408, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 364.90787946474074, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 364.90787946474074, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 207.84216850772367, Y: 191.19069756332618, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 273.38666061244413, Y: 51.82216607440938, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 340.6281019557299, Y: 97.8882618601383, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 256.4256601380679, Y: 258.24212812975236, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 313.5, Y: 364.9078794647408, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 412.54701234460833, Y: 238.40488427514296, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 486.0, Y: 364.9078794647408, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 573.5, Y: 364.9078794647408, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'SUGP2, -5.2 ± 0.8
 kcal/mol, AUC: 0.681', X: 225.0, Y: 377.7078794647408, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 591.5, 377.7078794647408)
Updated viewBox: -0.25 0.0 596.75 382.7078794647408
Updated SVG: /disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/final_image/SUGP2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/f6193333-b432-441c-b5ac-4d360f8a6f29/final_image/SUGP2_fold_final_1.svg
