Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 21% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 42% [======================                            ] /                     
 47% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 63% [================================                  ] /                     
 68% [===================================               ] -                     
 73% [=====================================             ] \                     
 78% [========================================          ] |                     
 84% [===========================================       ] /                     
 89% [=============================================     ] -                     
 94% [================================================  ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.24 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.24 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.24 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.90 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.35 seconds
write fasta - Current memory usage: 172.90 MB
Length of region: 95 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.49 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 176.49 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.49 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.49 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGGCAAAGAUUUAAUUGAAAUCCAAAAUGAUUUAUAGAAACGAAAGGCAUUUUCCAUUUGUUGUCUUCUGCCGAAAUUCUGAAUUGCAUACACAC', '-structureDBN', '.((((((((........(((((......))))).....((((((.((......)).)))))).)))).)))).......................', '-o', '/disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -9.7 ± 0.6\n kcal/mol, AUC: 0.595', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,8,10,11,12,15,16,17,21,28,29,31,32,33,35,37,42,46,47,50,51,52,53,57,58,59,60,61,62,63,64,66,67,69,70,73,77,78,80,81,84,85,86,89', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '34,6,7,39,71,74,75,20,55,24,25', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,65,72,76,79,82,19,22,90,26,27,93,30,40,44,45,48,56', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '4,5,68,9,13,14,18,83,23,87,88,91,92,94,95,36,38,41,43,49,54']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.6701562102474, Y: 342.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 163.6701562102474, Y: 322.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.6701562102474, Y: 302.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.85455296956945, Y: 285.2565500410295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.34306112400026, Y: 267.1580830738301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.83156927843106, Y: 249.05961610663064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.32007743286192, Y: 230.9611491394312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 117.2220736649698, Y: 231.7089707385337, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 100.55041312356832, Y: 227.84158081984026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 85.52782890454807, Y: 219.64262153384664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.25610753150028, Y: 207.71342103535483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.63528171736976, Y: 192.92889086786698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.29762015612806, Y: 176.37335819232123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.56125566583074, Y: 159.26103905349737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 65.40685268826127, Y: 142.84698533459084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.47902539763692, Y: 128.33503672931397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.920252264788076, Y: 112.01343252925659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 51.361479131939234, Y: 95.69182832919921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.80270599909039, Y: 79.37022412914177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 28.24393286624155, Y: 63.04861992908434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 12.297824286448076, Y: 55.83954419217389, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 40.05095653019555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 9.152918447018521, Y: 23.113912485617448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 23.43430234537874, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.87247656845767, Y: 14.46943240219457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 53.25999128063751, Y: 26.830606742628447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.766539691334856, Y: 44.26561358820493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 66.3253128241837, Y: 60.587217788262365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 77.88408595703254, Y: 76.9088219883198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.44285908988138, Y: 93.23042618837724, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 101.00163222273022, Y: 109.55203038843467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.09033945563777, Y: 105.78028210574485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.55823800142622, Y: 106.8397727352658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.065809233864, Y: 112.64925567318642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.34717683235493, Y: 122.76323310626265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.3071799877099, Y: 136.4061188286679, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 224.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.10535535903705, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.2808917891198, Y: 145.85333660017858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 316.45642821920256, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 336.45642821920256, Y: 152.53171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 351.55548483178734, Y: 143.684813660165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 368.8024181953064, Y: 146.65001877506097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 380.07978788345747, Y: 160.03172586854663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 380.07978788345747, Y: 177.53170163478904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.8024181953064, Y: 190.9134087282747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 351.55548483178734, Y: 193.87861384317068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 336.45642821920256, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.45642821920256, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.2808917891198, Y: 191.7100909031571, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 224.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 204.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.10535535903705, Y: 185.03171375166784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 176.38878754418255, Y: 202.64942305280465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 163.730086254561, Y: 217.12997489038128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 172.2415781001302, Y: 235.22844185758072, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 180.75306994569934, Y: 253.32690882478016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 189.26456179126853, Y: 271.4253757919796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 199.985790702491, Y: 285.25668992452563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 196.1701562102474, Y: 302.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 196.1701562102474, Y: 322.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.1701562102474, Y: 342.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 213.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 248.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 283.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 318.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 336.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 353.6701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 371.1701562102474, Y: 362.3356516441853, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.6701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 406.1701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 423.6701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 441.1701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 458.6701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 476.1701562102474, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 493.67015621024734, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 511.17015621024734, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 528.6701562102473, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 546.1701562102473, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 563.6701562102473, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 581.1701562102473, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 598.6701562102473, Y: 362.33565164418536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 146.9201562102474, Y: 382.3356516441853, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 111.6323501733786, Y: 251.62417642349934, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 31.28987493188184, Y: 107.25060146204811, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 78.8969170242411, Y: 49.02844465541352, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 200.35535535903705, Y: 132.53171375166784, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 395.1163258065293, Y: 153.17125993211175, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 220.35535535903705, Y: 205.03171375166784, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 212.4201562102474, Y: 322.3356516441853, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 332.4201562102474, Y: 382.3356516441853, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 507.42015621024734, Y: 382.33565164418536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '95', X: 594.9201562102473, Y: 382.33565164418536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -9.7 ± 0.6
 kcal/mol, AUC: 0.595', X: 235.71007810512367, Y: 395.1356516441854, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 612.9201562102473, 395.1356516441854)
Updated viewBox: -0.25 0.0 618.1701562102473 400.1356516441854
Updated SVG: /disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/f898f62f-f295-4939-ad18-c3e5874fedc8/final_image/CLOCK_fold_final_1.svg
