Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/final_image/MALAT1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.75 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.75 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.75 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.30 MB
Based on canonical annotations, the following gene is in your area of interest: MALAT1(+)
write fasta - Elapsed time since the previous call: 0.55 seconds
write fasta - Current memory usage: 172.30 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.81 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/fasta/MALAT1.fasta" "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/ct/MALAT1.ct" --SHAPE "MALAT1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.81 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/ct/MALAT1.ct" "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/fold_FE/MALAT1.txt" -sh "MALAT1.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 175.81 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/ct/MALAT1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/fold_dbn/MALAT1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.81 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACUUUUAGAAGAAAAAAGAUAAAUUUAAACCUGAAAAGUAGGAAGCAGAAGAAAAAAGACAAGCUAGGAAACAAA', '-structureDBN', '.............................((((.....)))).................................', '-o', '/disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/final_image/MALAT1_fold_1.svg', '-title', 'MALAT1, -0.9 ± 0.4\n kcal/mol, AUC: 0.362', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,3,4,5,6,67,8,68,11,18,20,24,25,26,32,33,38,39,41,42,45,48,51,58,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '52,21,53,73,12,13', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,69,7,40,43,17,57,27,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,9,10,14,15,16,19,22,23,28,29,30,31,34,35,36,37,44,46,47,49,50,54,55,56,59,60,61,64,70,71,72,74,75']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 112.03102042665246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 112.03102042665246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 112.03102042665246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 112.03102042665246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 372.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 407.25, Y: 112.03102042665247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 424.75, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 442.25, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 459.75, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 477.25, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 494.75, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 512.25, Y: 112.03102042665249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 512.25, Y: 92.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 512.25, Y: 72.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 512.25, Y: 52.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 505.6018303951821, Y: 35.84298012699786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.3280496512216, Y: 19.687213900744467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 528.5, Y: 13.000000000000028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.6719503487785, Y: 19.687213900744467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 551.3981696048179, Y: 35.84298012699786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 544.75, Y: 52.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.75, Y: 72.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 544.75, Y: 92.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 544.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 562.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 579.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 597.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 614.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 632.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 649.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 667.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 684.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 702.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 719.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 737.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 754.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 772.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 789.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 807.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 824.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 842.25, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 859.75, Y: 112.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 877.25, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 894.75, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 912.25, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 929.75, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 947.25, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 964.75, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 982.25, Y: 112.03102042665252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 999.75, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1017.25, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1034.75, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1052.25, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1069.75, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1087.25, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1104.75, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1122.25, Y: 112.03102042665253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 132.03102042665245, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 132.03102042665247, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 132.03102042665247, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 494.35786437626905, Y: 126.17315605038344, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 561.0, Y: 72.0310204266525, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 681.0, Y: 132.0310204266525, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 856.0, Y: 132.0310204266525, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 1031.0, Y: 132.03102042665253, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 1118.5, Y: 132.03102042665253, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MALAT1, -0.9 ± 0.4
 kcal/mol, AUC: 0.362', X: 497.5, Y: 144.83102042665254, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.000000000000028, 1136.5, 144.83102042665254)
Updated viewBox: -0.25 2.842170943040401e-14 1141.75 149.83102042665251
Updated SVG: /disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/final_image/MALAT1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/f9f55189-c006-4ef3-bbde-cab102e9f5bb/final_image/MALAT1_fold_final_1.svg
