Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.37 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.37 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.37 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.98 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 0.58 seconds
write fasta - Current memory usage: 171.98 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 174.98 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 174.98 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 174.98 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.98 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGAGGUCCAAGUGAUUCUGUGCAUUGAAACCAAGACACCCCACCCAGAACACUUCUUCCCUCCCUCAGCCCAAAC', '-structureDBN', '.((((...(((((.(((((((..(((....)))..)).......))))))))))....)))).............', '-o', '/disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -15.3 ± 1.2\n kcal/mol, AUC: 0.59', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,2,4,5,6,68,11,12,13,15,16,18,19,20,21,24,25,26,34,47,53,54,56,57,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,66,69,70,7,72,27,31,32,37,45,51,52,55,58,59,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '67,71,8,9,10,17,28,35,36,38,39,40,41,44,46,49,50,60,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,33,3,73,42,43,74,75,14,48,22,23,29,30']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 145.74138072384463, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.24138072384463, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.24138072384463, Y: 375.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.24138072384463, Y: 355.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.24138072384463, Y: 335.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 150.00143340011232, Y: 324.1354767409513, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.7101607444358, Y: 307.80536571675816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 145.84996645365555, Y: 290.4366044132764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.9166511284647, Y: 276.1217695435164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.06259672355768, Y: 256.71975532245676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 146.20854231865064, Y: 237.31774110139705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 141.3544879137436, Y: 217.91572688033736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 136.5004335088366, Y: 198.51371265927767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 128.65377148987082, Y: 182.87139297876226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.6976555780989, Y: 166.8515313445618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 139.56224950285207, Y: 147.22846038722275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.42684342760523, Y: 127.60538942988376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 147.29143735235843, Y: 107.98231847254476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 151.1560312771116, Y: 88.35924751520577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 141.13651358025805, Y: 76.17401301867255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 121.13651358025805, Y: 76.17401301867255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.04707435912698, Y: 86.55369633607427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.54707083525602, Y: 86.55369633607427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 75.45763161412498, Y: 76.17401301867255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.45763161412498, Y: 76.17401301867255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 35.45763161412498, Y: 76.17401301867255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.32118694653377, Y: 79.7227474059116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 68.67403089860557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 51.17399513873954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 18.32118694653377, Y: 40.12527863143339, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 35.45763161412498, Y: 43.674013018672554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 55.45763161412498, Y: 43.674013018672554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 75.45763161412498, Y: 43.674013018672554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.54707083525602, Y: 33.294329701270726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.04707435912698, Y: 33.294329701270726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 121.13651358025805, Y: 43.674013018672554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.13651358025808, Y: 43.674013018672554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 152.76170137620005, Y: 30.30721402338122, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 169.35022524537345, Y: 24.091332548215973, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 186.89681892021298, Y: 26.527180877139358, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 201.16489207413105, Y: 37.02662825049572, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.70944667371373, Y: 53.05460387330447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 207.70886493790783, Y: 70.74118474303202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 198.40473534715747, Y: 85.81598090185162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 183.04352158278743, Y: 94.63921264292969, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.17892765803427, Y: 114.26228360026869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 175.3143337332811, Y: 133.88535455760768, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.44973980852794, Y: 153.50842551494668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 167.58514588377477, Y: 173.13149647228573, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 168.0287066180586, Y: 190.62587425130377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 172.88276102296564, Y: 210.02788847236346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.73681542787264, Y: 229.42990269342314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 182.59086983277967, Y: 248.83191691448283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 187.4449242376867, Y: 268.23393113554255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 203.0663454152567, Y: 276.12197274249206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 213.1328787779849, Y: 290.43682188794514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.2725817059662, Y: 307.8055199214763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.9812833604483, Y: 324.13554028667136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.74138072384463, Y: 335.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.74138072384463, Y: 355.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.74138072384463, Y: 375.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.74138072384463, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 213.24138072384463, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 230.74138072384463, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 248.2413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 265.7413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 283.2413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 300.7413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 318.2413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.7413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 353.2413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 370.7413807238446, Y: 395.57909647228314, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.2413807238446, Y: 395.5790964722832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.7413807238446, Y: 395.5790964722832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 423.2413807238446, Y: 395.5790964722832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 146.49138072384463, Y: 415.57909647228314, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 127.91058250249796, Y: 261.5738097273637, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 119.53342195491757, Y: 85.18884077172459, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 9.825903140896315, Y: 20.696375378703067, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 190.67965163744245, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 183.68072083911832, Y: 185.7718198463968, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 211.99138072384463, Y: 355.57909647228314, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 331.9913807238446, Y: 415.57909647228314, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 419.4913807238446, Y: 415.5790964722832, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -15.3 ± 1.2
 kcal/mol, AUC: 0.59', X: 152.4956903619223, Y: 428.3790964722832, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 437.4913807238446, 428.3790964722832)
Updated viewBox: -0.25 -5.0 442.7413807238446 438.3790964722832
Updated SVG: /disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/fa7c6e4d-fc43-4296-bfda-50a9e68898d4/final_image/MLLT6_fold_final_1.svg
