Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 27% [==============                                    ] -                     
 33% [=================                                 ] \                     
 38% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 55% [============================                      ] \                     
 61% [===============================                   ] |                     
 66% [==================================                ] /                     
 72% [=====================================             ] -                     
 77% [=======================================           ] \                     
 83% [==========================================        ] |                     
 88% [=============================================     ] /                     
 94% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.04 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.04 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.04 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.60 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.65 seconds
write fasta - Current memory usage: 172.60 MB
Length of region: 90 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 176.25 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.25 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAUCUGCUGGAAAGUGAUUCAUUAACCCCAGAAUAUUUAAAAUCAAAAAAUCAGUUAGAAUUCUGUUGUCACAUGCUGCGAGGAACAAUA', '-structureDBN', '..((((((((....(((((..((((...........))))))))).....))))).))).((((.((((........)))))))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -7.5 ± 0.9\n kcal/mol, AUC: 0.647', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,6,8,9,10,14,15,16,18,19,22,23,31,34,36,37,38,43,51,54,55,56,58,61,62,64,65,66,67,68,69,74,75,77,78,80,82,83,89', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '40,44,45,46,48,50,84,24', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '4,39,42,85,90,27,28,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,7,11,12,13,17,20,21,25,26,29,32,33,35,41,47,49,52,53,57,59,60,63,70,71,72,73,76,79,81,86,87,88']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.31173589244318, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.81173589244318, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.31173589244318, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.31173589244318, Y: 418.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.31173589244318, Y: 398.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 173.49613265176524, Y: 381.66024209173435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.98464080619604, Y: 363.5617751245349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 156.47314896062687, Y: 345.46330815733546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.96165711505768, Y: 327.364841190136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.4501652694885, Y: 309.2663742229366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.24822259625816, Y: 306.62076659784884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.33993785419477, Y: 297.8994248647065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.90187088106381, Y: 284.4671846232851, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 96.4110203075972, Y: 268.4261077153499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 99.41368248152997, Y: 252.28652265371352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 85.27154685779902, Y: 238.14438702998257, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 71.12941123406807, Y: 224.00225140625162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 56.98727561033712, Y: 209.86011578252067, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 42.84513998660617, Y: 195.71798015878971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 26.672576861786865, Y: 188.99005907616106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.969423247933378, Y: 172.80721471092585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 26.647793681845997, Y: 156.614127035384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 26.647793681845997, Y: 136.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 26.647793681845997, Y: 116.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 26.647793681845997, Y: 96.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 12.772572019920347, Y: 85.94982409133036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.949424521785943, Y: 70.29583109680789, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 52.79699218360474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 12.214362292414648, Y: 36.96877595379226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 25.842941547360056, Y: 25.991027507877106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 42.897793681846, Y: 22.069146311187865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.95264581633188, Y: 25.991027507876993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.58122507127729, Y: 36.96877595379226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 81.04558736369202, Y: 52.79699218360474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 80.84616284190605, Y: 70.29583109680789, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.02301534377168, Y: 85.94982409133036, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 59.147793681846, Y: 96.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 59.147793681846, Y: 116.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.147793681846, Y: 136.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.147793681846, Y: 156.61412703538394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 65.82611037516898, Y: 172.7370097702269, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.96824599889993, Y: 186.87914539395786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 94.11038162263088, Y: 201.0212810176888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 108.25251724636183, Y: 215.16341664141976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.39465287009278, Y: 229.3055522651507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 140.56161005918344, Y: 226.38325203334261, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 158.20621980259233, Y: 231.6030143993779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.85947044610575, Y: 243.9386100080414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.8370699430866, Y: 260.96480386970086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.76719005105963, Y: 279.3341677446889, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 168.86017409118762, Y: 295.43519997388665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.37166593675678, Y: 313.5336669410861, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.88315778232595, Y: 331.63213390828554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.39464962789515, Y: 349.730600875485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 202.90614147346432, Y: 367.8290678426844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 213.62737038468674, Y: 381.6603819752305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.81173589244318, Y: 398.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.81173589244318, Y: 418.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.81173589244318, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.31173589244318, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.81173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.81173589244315, Y: 418.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.81173589244315, Y: 398.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.81173589244315, Y: 378.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.99611702586049, Y: 361.66031203345517, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 251.71745798499995, Y: 347.8290027004528, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 260.22907600024774, Y: 329.7305950698763, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 268.74069401549554, Y: 311.6321874392998, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 277.2523120307433, Y: 293.53377980872335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 272.26098505707887, Y: 276.7606714475339, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.19256704166946, Y: 259.96989992912256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 290.4614755434305, Y: 248.5599667029319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 307.8015443709671, Y: 246.19934769289995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 323.6376642092461, Y: 253.64701964606087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.8782693844236, Y: 268.5084369758688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.55235761841953, Y: 286.0054164459092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.7647147538162, Y: 300.51239946131284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 306.6622244304301, Y: 307.365159083501, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.1506064151823, Y: 325.4635667140775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.63898839993453, Y: 343.561974344654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 281.12737038468674, Y: 361.66038197523045, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.31173589244315, Y: 378.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.31173589244315, Y: 398.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.31173589244315, Y: 418.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.31173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.81173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.31173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.81173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 347.31173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.81173589244315, Y: 438.7393436948902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 143.06173589244318, Y: 458.7393436948902, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 122.12478518807228, Y: 323.95341121632254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 8.76961984013802, Y: 203.12136501522275, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 13.356642032645105, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 69.57236861371771, Y: 142.50450530052677, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 193.2286802619384, Y: 284.89462131227754, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 223.56173589244318, Y: 458.7393436948902, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 248.5110167423643, Y: 276.79627215557855, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 303.987396030511, Y: 352.07359235990185, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 361.06173589244315, Y: 458.7393436948902, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -7.5 ± 0.9
 kcal/mol, AUC: 0.647', X: 118.78086794622158, Y: 471.5393436948902, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 379.06173589244315, 471.5393436948902)
Updated viewBox: -0.25 -5.0 384.31173589244315 481.5393436948902
Updated SVG: /disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/fb354e15-9ead-41c1-8d9e-33f543d06637/final_image/CLOCK_fold_final_1.svg
