Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.97 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.97 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.97 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.59 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 172.59 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 175.83 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.83 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.83 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.83 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CACCCACACAGUCCGAAGUAGACCAGUUAUCACUUCCCCAAGAGCUAAUGGCCGAGGCCCAAGCUGGCACCACCA', '-structureDBN', '..............(((((.((.......)))))))((....((((...(((....)))..))))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -15.1 ± 1.3\n kcal/mol, AUC: 0.726', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,66,67,11,12,15,18,19,21,26,27,28,30,34,35,42,44,46,49,50,51,54,56,57,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,36,37,38,6,68,70,71,74,75,13,45,52,58,59', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '33,2,5,72,43,14,16,17,20,53,22,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,4,69,7,8,9,10,73,23,24,25,29,31,32,39,40,41,47,48,55,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 183.56763660256038, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 163.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 143.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.75, Y: 123.56763660256041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 103.56763660256041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.93438113341733, Y: 86.4886049411254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 256.65572209255674, Y: 72.65729560812301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 265.16734010780453, Y: 54.558887977546505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 261.68242048137404, Y: 37.40938280609021, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 268.9967629013434, Y: 21.511251236879843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.2875704278018, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 301.65371863750534, Y: 15.160344599155053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.3931546035152, Y: 27.158551285840332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.5893952305279, Y: 44.364196821033715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.0089272724972, Y: 60.1371704774422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.5772525074914, Y: 68.39026725232418, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 286.0656344922436, Y: 86.48867488290068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 103.56763660256041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 123.56763660256041, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 143.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 163.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 163.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.370316451023, Y: 149.47819667665513, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 289.37031714574874, Y: 131.97819244801002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75000181338794, Y: 117.8887533462227, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 316.4635901426144, Y: 112.70164305592209, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.9964808946435, Y: 118.4386868403171, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.0977203192485, Y: 112.51056298500521, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 371.19895974385344, Y: 106.58243912969334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 390.3001991684584, Y: 100.65431527438147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 399.4639520440172, Y: 85.64502783407204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 415.3655684314161, Y: 78.13558894037624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 432.7784417163987, Y: 80.59423088081456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 445.97923934790333, Y: 92.2128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 465.97923934790333, Y: 92.2128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 485.97923934790333, Y: 92.2128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 503.1156840154945, Y: 88.66410304178962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 516.6868709620283, Y: 99.71281954909574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 516.6868709620283, Y: 117.21285530896171, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 503.1156840154945, Y: 128.2615718162678, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 485.97923934790333, Y: 124.7128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 465.97923934790333, Y: 124.7128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 445.97923934790333, Y: 124.7128374290287, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 432.9675436572976, Y: 136.24370854004326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 415.7781977739448, Y: 138.84977865157504, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 399.9334004333402, Y: 131.6938293393645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 380.8321610087352, Y: 137.6219531946764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 361.7309215841303, Y: 143.55007704998826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 342.6296821595253, Y: 149.47820090530013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 163.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 183.5676366025604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 203.56763660256038, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 203.5676366025604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 222.66556773952055, Y: 82.12787980713276, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 310.0918344246636, Y: 73.76389578028937, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 266.61973511400146, Y: 125.73496552158473, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 446.5059849706041, Y: 72.67545155274757, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 437.6964852362865, Y: 154.35744779233715, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 381.0, Y: 203.5676366025604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 468.5, Y: 203.5676366025604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -15.1 ± 1.3
 kcal/mol, AUC: 0.726', X: 194.71843548101413, Y: 216.36763660256042, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 527.1868709620283, 216.36763660256042)
Updated viewBox: -0.25 0.0 532.4368709620283 221.36763660256042
Updated SVG: /disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/fe176e3d-4574-4b8a-848a-559e33f2acd6/final_image/HCFC1_fold_final_1.svg
